ID: 1016264186

View in Genome Browser
Species Human (GRCh38)
Location 6:142212748-142212770
Sequence CTGTCTCCTGCTGCCATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1250
Summary {0: 2, 1: 10, 2: 51, 3: 200, 4: 987}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016264186_1016264192 -10 Left 1016264186 6:142212748-142212770 CCTCACATGGCAGCAGGAGACAG 0: 2
1: 10
2: 51
3: 200
4: 987
Right 1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG 0: 1
1: 15
2: 120
3: 806
4: 3997

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016264186 Original CRISPR CTGTCTCCTGCTGCCATGTG AGG (reversed) Intronic
900365835 1:2311638-2311660 CTGCCTCCAGCAGCCACGTGGGG + Intergenic
900554248 1:3271846-3271868 CTCTCTTCTGCTCCCATCTGGGG + Intronic
900585343 1:3429949-3429971 CTGCCTCCCGCTGCCCTGGGAGG - Intronic
901213372 1:7539214-7539236 CTGCCTGTTGCAGCCATGTGGGG - Intronic
901490028 1:9591939-9591961 CTGTCACCAGCTGCCCTGGGAGG + Intronic
901636202 1:10671434-10671456 ATGGCTCCTGCAGCCATGAGGGG + Intronic
901761041 1:11471805-11471827 CTGCATCCTGCTGCCAGATGTGG + Intergenic
901943075 1:12678671-12678693 CTGAAGCCAGCTGCCATGTGGGG - Intergenic
902039379 1:13481815-13481837 CTCTCTCTCTCTGCCATGTGAGG + Intronic
902189490 1:14752027-14752049 CTTTCACCTTCTGCCATGAGTGG - Intronic
902337599 1:15762816-15762838 CAGTTTCCTGCTGCCAAGGGTGG - Intronic
903082323 1:20820474-20820496 CTGCCTCCTGCTGCCATTCATGG - Intronic
903149081 1:21392646-21392668 CTCTCTCCTGCTGCCTAGGGAGG - Intergenic
903307645 1:22424471-22424493 CTCTTGCCTGCTGCCATGTAAGG - Intergenic
903589689 1:24445334-24445356 CTGCCTCCTGCTGTCCTCTGTGG + Intronic
903681162 1:25098190-25098212 CACTCTCCTGCTGCCTTGTCTGG + Intergenic
903985265 1:27222892-27222914 TTGCTTCCTACTGCCATGTGAGG - Intergenic
903996305 1:27307308-27307330 CTGTCCCCTGCTGCTCTGAGGGG + Exonic
904352852 1:29920265-29920287 CTGGGCCCTTCTGCCATGTGAGG + Intergenic
904358362 1:29956190-29956212 CTCTTGCCTGCTGCCATGTAAGG + Intergenic
905001258 1:34671627-34671649 CTGCCTCCTGCTGCCATCCATGG - Intergenic
905288561 1:36905084-36905106 CTGTTTATTGCTGCTATGTGGGG - Intronic
905463910 1:38138830-38138852 CTGTCTCTTGGTGTCATCTGAGG + Intergenic
905490471 1:38339696-38339718 CTTTCTCTTCCTGCCATGTCAGG + Intergenic
906823295 1:48951594-48951616 CATTCTCTTTCTGCCATGTGAGG + Intronic
907620891 1:55978458-55978480 CTCTCTCCTCATGTCATGTGAGG + Intergenic
908428200 1:64029630-64029652 CTGTCTCTCTCTGCCATGTAAGG - Intronic
908499473 1:64728904-64728926 CTTCCACCTTCTGCCATGTGAGG + Intergenic
908644866 1:66266348-66266370 CTGTCTCCTGCTCCTCTTTGGGG - Intronic
908901100 1:68957534-68957556 CTCGCCCCTTCTGCCATGTGAGG + Intergenic
908905685 1:69006200-69006222 CTTTCTCCTTCCACCATGTGAGG - Intergenic
908962951 1:69723807-69723829 CTTGCTCCTTCTACCATGTGAGG - Intronic
909072599 1:71014631-71014653 GTCTCTCCTTCAGCCATGTGGGG + Intronic
909285407 1:73810203-73810225 TTGTCTTCTGCTACCATTTGGGG + Intergenic
909352006 1:74665135-74665157 CTCACCCCTTCTGCCATGTGAGG + Intronic
909364895 1:74808123-74808145 CTTTCCCCTTCTGCCATGAGTGG - Intergenic
909823461 1:80095908-80095930 CTCTCTCCTGCTGCCATGTAAGG - Intergenic
910462803 1:87466780-87466802 GTGTCTCCTGCTGCCAAGAGCGG + Intergenic
910723703 1:90315366-90315388 CACTCTCTTTCTGCCATGTGAGG - Intergenic
911547709 1:99239867-99239889 CTCTCTCCAGCTCCCATTTGAGG + Intergenic
912509140 1:110176516-110176538 CTGTTTTCTGCTGCCATCAGGGG + Intronic
913066003 1:115255578-115255600 CTCACCCCTTCTGCCATGTGAGG + Intergenic
913144082 1:115972274-115972296 CTTCCACCTTCTGCCATGTGAGG - Intergenic
913383796 1:118238165-118238187 CTCTTTCTTGCTGCCCTGTGAGG + Intergenic
913435250 1:118840963-118840985 TTATCCCCTTCTGCCATGTGAGG - Intergenic
914382835 1:147134175-147134197 CTTTCACCTTCTGCCATGAGTGG - Intergenic
915017284 1:152745861-152745883 CAGTCTCCAGGTGCCCTGTGAGG - Intronic
915275381 1:154784615-154784637 CCTTCTCCAGCTGCCATTTGGGG - Intronic
915296933 1:154928048-154928070 GTGTCTACTTCTGCCAGGTGTGG - Intronic
915507010 1:156364188-156364210 CTGTCTCTCTCTGCCATGTGAGG - Intronic
915665317 1:157439182-157439204 CTTTTTTCTGCTGCCTTGTGAGG - Intergenic
915982933 1:160433292-160433314 CTCTCTCTCTCTGCCATGTGAGG - Intergenic
916014915 1:160741448-160741470 CTGTCTGTGGCTGCCTTGTGTGG + Intronic
916086137 1:161270910-161270932 CTCTCCCCTTCTACCATGTGAGG + Intronic
916182231 1:162095314-162095336 ATCTCTCTTGCTGCCCTGTGAGG + Intronic
916587534 1:166161608-166161630 CTGTCTACTGCTACCATCTCAGG - Intronic
916685089 1:167136934-167136956 CTTTCTCTTCCTGCCATGTGAGG + Intergenic
916816979 1:168363677-168363699 CTCCCACCTTCTGCCATGTGAGG + Intergenic
916882594 1:169034360-169034382 CTTTCCCCTTCTCCCATGTGAGG - Intergenic
916910406 1:169340299-169340321 CTCTCTCCTGCCGCCTTGTGAGG + Intronic
916970810 1:170013061-170013083 ATTTCCCCTTCTGCCATGTGAGG + Intronic
917186954 1:172367992-172368014 CTTCTTGCTGCTGCCATGTGAGG + Intronic
917290591 1:173468694-173468716 CTCCTTGCTGCTGCCATGTGAGG - Intergenic
917517518 1:175720266-175720288 CTCTCTCTTTCTGTCATGTGAGG + Intronic
919055830 1:192569117-192569139 CTGTCACCTCCTGCCATGATTGG - Intergenic
919454630 1:197806594-197806616 ATTCCACCTGCTGCCATGTGAGG - Intergenic
919830960 1:201539790-201539812 CTGGCTCCTGCTGGGATGGGAGG - Intergenic
920161611 1:204002818-204002840 CTTTCTCTCCCTGCCATGTGAGG + Intergenic
920226387 1:204442287-204442309 CTTTCTATTTCTGCCATGTGTGG + Intronic
920226643 1:204443834-204443856 CTTTCTATTTCTGCCATGTGTGG + Intronic
920253761 1:204640229-204640251 CTCTCCCTTCCTGCCATGTGAGG - Intronic
920396136 1:205647512-205647534 CTTGCCCCTTCTGCCATGTGAGG - Intergenic
921540101 1:216403936-216403958 CTCTCTCCTGACGCCACGTGAGG + Intronic
921728097 1:218546506-218546528 ATTCCTGCTGCTGCCATGTGAGG - Intergenic
922394291 1:225180469-225180491 CTTTCACTTTCTGCCATGTGTGG - Intronic
922667961 1:227488873-227488895 CTCACGCCTGCTGCCATGTAAGG - Intergenic
923038280 1:230300799-230300821 CTGTCACCTGCTTCCATCTCTGG - Intergenic
923127334 1:231043429-231043451 CTGGCCCCTTCTGCAATGTGAGG - Intergenic
923416856 1:233770861-233770883 CTTCCCCCTTCTGCCATGTGAGG + Intergenic
923476882 1:234342312-234342334 CTTGCTCCTGCCACCATGTGAGG + Intergenic
923676856 1:236087875-236087897 CTTCCACCTTCTGCCATGTGAGG - Intergenic
923881148 1:238105240-238105262 CTATCTCTTTCTGCCATGTGAGG - Intergenic
924136353 1:240971163-240971185 CTCTCCCCTTCTACCATGTGAGG + Intronic
924494869 1:244577601-244577623 CTTGCCCCTTCTGCCATGTGAGG - Intronic
924810185 1:247394157-247394179 TTGCCTCTTTCTGCCATGTGAGG - Intergenic
1062926868 10:1322943-1322965 CTTTCTCCTGGTGCCAAATGTGG - Intronic
1063229841 10:4054208-4054230 CTCTCTTCTGCTGCCTTGTGAGG - Intergenic
1063276833 10:4578446-4578468 CTCACCCCTTCTGCCATGTGAGG - Intergenic
1063419271 10:5898302-5898324 CTTACTCCTGCCACCATGTGAGG - Intronic
1063752050 10:8960810-8960832 CTCTCTTTTTCTGCCATGTGAGG - Intergenic
1063967584 10:11359004-11359026 CTTACCCCTTCTGCCATGTGAGG + Intergenic
1064279289 10:13936557-13936579 CTCACCCCTTCTGCCATGTGAGG + Intronic
1064367993 10:14725581-14725603 CTTTCTCCCCCTACCATGTGAGG - Intronic
1065089516 10:22217984-22218006 CTAGGTCCTGCTGCCCTGTGAGG - Intergenic
1065764048 10:29009773-29009795 CTCTCTCTCTCTGCCATGTGAGG - Intergenic
1065786947 10:29224654-29224676 CTGTCCCCTGCTGCCTTCTCAGG - Intergenic
1066008533 10:31170817-31170839 CTCTTTCCTGCCACCATGTGAGG - Intergenic
1066533977 10:36370389-36370411 CTTTTGCCTTCTGCCATGTGAGG + Intergenic
1066537894 10:36411228-36411250 CTTTCACCTTCTGCCATGGGAGG + Intergenic
1066985993 10:42466860-42466882 CTTTCACCTGCCTCCATGTGAGG - Intergenic
1067049097 10:43001718-43001740 CTGTCTGCTGCTGGCAGGTCAGG - Intergenic
1067421894 10:46159273-46159295 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1067507201 10:46865362-46865384 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1067543389 10:47174262-47174284 CTCTCTCTTTCTGCCATGTGAGG + Intergenic
1067739248 10:48882078-48882100 CTGATTCCTGCTGCCCTGTCAGG - Intronic
1067751077 10:48971659-48971681 TTGTCTCCTGGTGCCATGCAGGG + Intronic
1068068794 10:52169387-52169409 CTTGTTCCTTCTGCCATGTGAGG - Intronic
1068083557 10:52347605-52347627 CTGTCTCCTGTTGCCATCTATGG - Intergenic
1068314862 10:55327175-55327197 CTGGCCCCTTCTGCCATGTGAGG + Intronic
1068348430 10:55813694-55813716 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1068604363 10:58989204-58989226 CTCTCTCCTGCTACTATGTGAGG + Intergenic
1068659657 10:59611109-59611131 CTCTCTCCCCCTGCCATCTGAGG + Intergenic
1068902672 10:62287493-62287515 CTTGCCCCTTCTGCCATGTGAGG - Intergenic
1068972573 10:62974990-62975012 CTCTTGCCTGCTGCCATGTAAGG - Intergenic
1069747550 10:70725565-70725587 CTCACTCCTTCTACCATGTGAGG - Intronic
1069846382 10:71374640-71374662 CTTTCTCCCGCTGCCAGCTGAGG - Intergenic
1070859379 10:79638409-79638431 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1071877076 10:89853347-89853369 CTTTCTCCTGCTGCCTTGTGAGG + Intergenic
1071884129 10:89931001-89931023 CTCTCTCCTTCCACCATGTGAGG + Intergenic
1072313612 10:94180810-94180832 CTTTCACCTTCTGCCATGTGAGG + Intronic
1072474390 10:95745818-95745840 CCTTCTCCTGCTGCCACGTTGGG + Intronic
1073094824 10:100973050-100973072 CTGGCTTCTGCTGCCTTTTGAGG - Intronic
1073670275 10:105579945-105579967 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1073830059 10:107373447-107373469 CTCTCTCCTGCCACCCTGTGAGG + Intergenic
1074099649 10:110344641-110344663 CTTTCACCTTCTGCCATGAGTGG - Intergenic
1074489562 10:113927028-113927050 CTAGCCCCTTCTGCCATGTGAGG + Intergenic
1074492752 10:113953871-113953893 CTTCCTCTTTCTGCCATGTGAGG + Intergenic
1074532662 10:114307596-114307618 CTCTCTCTTGCTGCAATGTTGGG - Intronic
1074671920 10:115800748-115800770 CTCTCTCTTTCTGTCATGTGAGG + Intronic
1074914335 10:117941000-117941022 CTGTCTCTCTCTGCCATGTGGGG + Intergenic
1074991575 10:118712999-118713021 CTGCCTCCTGCTGCCATTCATGG + Intronic
1075003533 10:118814845-118814867 CTCACCCCTTCTGCCATGTGAGG - Intergenic
1075133575 10:119762357-119762379 CTCACGCCTCCTGCCATGTGAGG - Intronic
1075647710 10:124107521-124107543 CTGTATCCTGCTGCCTGTTGGGG + Intergenic
1075758378 10:124834804-124834826 CTGTCTCCAGCTGCTCTTTGGGG - Exonic
1076398094 10:130156249-130156271 TCTTCTCCTGCTGCCAAGTGAGG - Intronic
1076473207 10:130734595-130734617 CTGTCTGCTGGTGGCATGTTTGG + Intergenic
1076838761 10:133034263-133034285 CTGTTTCCTCCTGCAATCTGGGG - Intergenic
1077136376 11:1001386-1001408 CTCTCCCCTGCTGCCCTGTGGGG + Intronic
1077396858 11:2328528-2328550 CTTTCCCTTTCTGCCATGTGAGG - Intergenic
1077548113 11:3185356-3185378 CTCTCTGCTTCTGCCAGGTGAGG - Intergenic
1077573876 11:3363326-3363348 GTGTCTCCTGCTGTGTTGTGTGG - Intronic
1077931111 11:6734039-6734061 CTGTGCTCTTCTGCCATGTGAGG + Intergenic
1077956617 11:7027406-7027428 CTGGTTCCTTCTGCCATGTGAGG - Intronic
1078379339 11:10825964-10825986 TTTGCTCCTTCTGCCATGTGAGG + Intronic
1078452039 11:11447647-11447669 CTCTCTCCTGCCACCCTGTGAGG - Intronic
1078460528 11:11511757-11511779 CAGTCTCTTTTTGCCATGTGAGG + Intronic
1078499018 11:11850890-11850912 TTGTCTCCTTCCACCATGTGAGG - Intronic
1078717535 11:13854283-13854305 CTGTCTGCAGCTGGCTTGTGTGG - Intergenic
1078934429 11:15939180-15939202 CTGCCTCCTGCTGACCTTTGGGG + Intergenic
1079176884 11:18150499-18150521 CTCTCTCCTGCTGCCATGTAAGG - Intronic
1079301028 11:19278960-19278982 CTCTTGCCTGCTGCCATGTATGG + Intergenic
1079539877 11:21560366-21560388 CTGTCTGCTCCTGCAAGGTGAGG + Exonic
1079588213 11:22151346-22151368 CACTCTCTTTCTGCCATGTGAGG - Intergenic
1079739415 11:24038072-24038094 CTCCTTCCTGCTGCCATGTAAGG - Intergenic
1079865713 11:25731144-25731166 CTCTGTCCTGCTGCCATGTAAGG - Intergenic
1079896579 11:26126787-26126809 CTTTCTCCTGCCACCATGTAAGG - Intergenic
1080081846 11:28229595-28229617 CTTTGTCCTTCTGCCATGTGAGG + Intronic
1080232730 11:30035730-30035752 CTTCCTCCTACTGCCATATGAGG + Intergenic
1080293703 11:30700866-30700888 CTCCTTCCTGCTGCCATATGAGG - Intergenic
1080397287 11:31901948-31901970 CTTGCCCCTTCTGCCATGTGAGG - Intronic
1080401204 11:31937616-31937638 CTCTCTCCTGCTGCCTTGTGAGG - Intronic
1080441063 11:32295062-32295084 CTTTCTCCTGCCGCCCTGTTAGG - Intergenic
1080623279 11:34005382-34005404 CTGTGTCCACCTGCCTTGTGTGG + Intergenic
1080947779 11:36994390-36994412 CTGTCTCCTTCTGTCAGATGTGG + Intergenic
1081003153 11:37699781-37699803 CTCTCTCCTGCTGCCACATAAGG - Intergenic
1081117987 11:39228966-39228988 CTGTGTCCTTCTACCATGTCAGG - Intergenic
1081160717 11:39744495-39744517 CTCTCTCCTGCCACCTTGTGAGG + Intergenic
1081271901 11:41095179-41095201 CTCTCTCCAGCCTCCATGTGAGG - Intronic
1081315418 11:41624598-41624620 CTCTCTCCTGCCACCATGTGAGG - Intergenic
1081686043 11:45043666-45043688 CTCTCTCCCCCTCCCATGTGAGG + Intergenic
1081935884 11:46903741-46903763 CTGCTTCCTGCTCCCCTGTGTGG - Intronic
1082943675 11:58735405-58735427 CTTTCACCTTATGCCATGTGTGG + Intergenic
1083085896 11:60145061-60145083 CTGTTTCCTGCTGACATGAATGG + Intergenic
1083468131 11:62862820-62862842 GTGCCTCTTGCTGCCAGGTGGGG - Intronic
1083594286 11:63911664-63911686 CTGTCTCCTGGGGCCATGGCCGG - Exonic
1083819573 11:65160575-65160597 CTGTCTTCTGATGGCTTGTGTGG + Intergenic
1083926455 11:65809842-65809864 CTGTTTCCTGCTGCCATGCCCGG - Intergenic
1084081103 11:66825522-66825544 CTTGCCCCTTCTGCCATGTGAGG + Intronic
1084421317 11:69062097-69062119 CCGTCTCCTTCTGCCATGAGTGG - Intronic
1084658625 11:70534250-70534272 CTCTCTCCTGCCGCCATGTGAGG - Intronic
1085110917 11:73887011-73887033 CCTTCTCCTTCTGCCATGAGTGG + Intronic
1085136493 11:74093901-74093923 CTCTCTCCTGTTGCCAGCTGAGG - Exonic
1085247299 11:75113208-75113230 CTCCTTCCTGCTGCCCTGTGAGG - Intronic
1085299426 11:75449707-75449729 CTGTCTCCATCTGCCAACTGGGG + Intronic
1085458359 11:76678421-76678443 CTCCATCTTGCTGCCATGTGGGG - Intergenic
1085532509 11:77200348-77200370 CCTTCTCCTTCTGCCATGAGTGG - Intronic
1085981275 11:81729597-81729619 CTCTCTCCTGCCACCATGTAAGG + Intergenic
1086400965 11:86460616-86460638 CTGTCTCCAGCTCCCACGTGTGG + Intronic
1086445519 11:86866869-86866891 CTTTCACCTTCTGCCATGAGTGG + Intronic
1087512679 11:99117757-99117779 TTCTCTTCTTCTGCCATGTGAGG + Intronic
1087612292 11:100448898-100448920 CTTCCTCTTCCTGCCATGTGAGG + Intergenic
1087659118 11:100965046-100965068 CTCTCTCCTGCTGCCATGTGAGG - Intronic
1087699262 11:101417338-101417360 CTTTCACCTTCTGCCATGAGTGG - Intergenic
1087729388 11:101760925-101760947 CTTGCTGCTTCTGCCATGTGAGG - Intronic
1087923150 11:103890061-103890083 CTCTCCCCCTCTGCCATGTGAGG - Intergenic
1088057017 11:105595983-105596005 CCCTCTCCTTCTGCCATGAGTGG + Intergenic
1089021290 11:115217779-115217801 CTGTCTCCTGCTGCAAAGGATGG - Intronic
1089333878 11:117709363-117709385 CGCTCTCCATCTGCCATGTGAGG - Intronic
1089561550 11:119345797-119345819 CTGACTCCTGCTGCCCTTTAGGG + Exonic
1090374475 11:126279286-126279308 CTTACCCCTTCTGCCATGTGAGG - Intergenic
1090560048 11:127922190-127922212 CTCCTTCCTGCTGCCATGTGAGG + Intergenic
1090729324 11:129556016-129556038 CTTTCACCTTCTGCCATGGGAGG + Intergenic
1090738348 11:129632670-129632692 CTGGCTTCTTCTGCCATGTGAGG - Intergenic
1090749373 11:129732450-129732472 CTCTCTCTTGATGCCAGGTGTGG - Intergenic
1091039402 11:132262537-132262559 CTCTCTCCCCCTGCCATGTGAGG - Intronic
1091146062 11:133281429-133281451 CTGTCACCTTCTGCCATGACTGG + Intronic
1091266342 11:134274470-134274492 CTGTGTCCTTTTGCCATCTGGGG - Intronic
1092730924 12:11533686-11533708 CTCTCACCTTCTGCCATGAGTGG - Intergenic
1093021614 12:14209182-14209204 TTTGCTCCTTCTGCCATGTGAGG - Intergenic
1093135197 12:15440927-15440949 CTGTCTACTGCTGTCAGTTGGGG - Intronic
1093313344 12:17618417-17618439 CTCTCTCCTGCCACCATGTGAGG - Intergenic
1093486192 12:19655723-19655745 CCTCCTCCTTCTGCCATGTGAGG + Intronic
1093680264 12:21994155-21994177 CTCTCTGCCTCTGCCATGTGAGG + Intergenic
1093696724 12:22169494-22169516 CCTTCACCTTCTGCCATGTGTGG - Intronic
1093979470 12:25459822-25459844 TTGGCTCCTGCCGCCATGTCTGG + Intronic
1094027420 12:25973740-25973762 CTGTTCCCTTCTACCATGTGAGG + Intronic
1094144440 12:27214169-27214191 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1094295151 12:28897485-28897507 CTCTTGTCTGCTGCCATGTGAGG + Intergenic
1094729382 12:33157190-33157212 CTCTTTCTTGCTGCCTTGTGTGG + Intergenic
1095039464 12:37425389-37425411 CTTTCACCTTCTGCCATGTGAGG - Intergenic
1095880778 12:47133913-47133935 CCCTCTCTTTCTGCCATGTGAGG + Intronic
1096004248 12:48156433-48156455 CTGTCTTCTGCTGCCATTCTTGG - Intronic
1096266044 12:50123459-50123481 CTTCCTCTTTCTGCCATGTGAGG - Intergenic
1096350191 12:50891777-50891799 CTGGCCCCTTTTGCCATGTGAGG - Intergenic
1096881017 12:54670683-54670705 CTGTCTCCTCCTGCCTTCTCAGG + Intergenic
1096897655 12:54840088-54840110 CTGGCTCTTGCTGCCCAGTGGGG + Intronic
1097078202 12:56410600-56410622 CTCTCTCCTGCTGCCATTCATGG + Intergenic
1097129979 12:56804750-56804772 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1097325555 12:58272424-58272446 CTTCCACCTACTGCCATGTGAGG - Intergenic
1097364491 12:58696234-58696256 CTCTCTCCTGCCACCATGTGAGG + Intronic
1097424563 12:59427529-59427551 CTTTCACCTTCTCCCATGTGAGG - Intergenic
1098015800 12:66103417-66103439 CTTCCACCTTCTGCCATGTGAGG + Intergenic
1098218345 12:68243030-68243052 CTCTTGTCTGCTGCCATGTGAGG - Intergenic
1098803030 12:74985734-74985756 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1098860128 12:75699937-75699959 CTCTCTCTCTCTGCCATGTGAGG + Intergenic
1099104603 12:78483100-78483122 TTGTCTCATTCTGCCCTGTGGGG + Intergenic
1099117554 12:78646698-78646720 CTGCCTCCTGATGTCATTTGAGG - Intergenic
1099339467 12:81410066-81410088 CAGCCACCTTCTGCCATGTGAGG + Intronic
1099621662 12:85009120-85009142 CTTTCACCTTCTGCCATGGGAGG - Intergenic
1099744096 12:86679677-86679699 CTAGCTCCTTCTACCATGTGAGG + Intronic
1099796968 12:87411626-87411648 CTCTTTCCTGCAGCCATGTGAGG + Intergenic
1100029476 12:90168458-90168480 CTCTCTCCTGCTGCCCTGTCAGG - Intergenic
1100465281 12:94839126-94839148 CTTTCACCTTCTGCCATGAGTGG - Intergenic
1100610093 12:96184698-96184720 CTCACTCCTTCTGCCGTGTGAGG + Intergenic
1100752191 12:97710589-97710611 CTTTCACCTTCTGCCATGTGAGG - Intergenic
1100762702 12:97826882-97826904 CTCTCTCCTTCTGCCACATGAGG + Intergenic
1100792132 12:98142330-98142352 CTTTCTCTTTCTGCCATGAGTGG + Intergenic
1100806305 12:98287499-98287521 CTTGCCCCTTCTGCCATGTGGGG + Intergenic
1100847874 12:98678954-98678976 CTGCCTCCTGCTGCCATGAATGG - Intronic
1100878700 12:98992520-98992542 CTCTGTGCTGCTGCCTTGTGAGG + Intronic
1100958450 12:99935982-99936004 CTTTCTCCTGCTGCCCTGTGAGG - Intronic
1101015959 12:100500749-100500771 CTCTCTCCTGCTGCCTTTTGAGG + Intronic
1101496194 12:105256612-105256634 CTCTCTCCTACCACCATGTGAGG - Intronic
1102060378 12:109926723-109926745 CTGCCTCCTGCTGCCATTCATGG - Intronic
1102750826 12:115292520-115292542 CTTTCCCCTTCGGCCATGTGAGG - Intergenic
1102879495 12:116473513-116473535 CTTTCACCTTCTTCCATGTGAGG + Intergenic
1102884500 12:116511400-116511422 CTGGCCCCTGCTGGCATTTGAGG + Intergenic
1103156679 12:118691282-118691304 CTGTCTCCTCTAGGCATGTGAGG + Intergenic
1103222126 12:119254730-119254752 TTGCCCCCTTCTGCCATGTGAGG - Intergenic
1103272245 12:119683090-119683112 CTGGCACCTTCTGCCATGTGAGG + Intergenic
1103524630 12:121559480-121559502 GTGTTTCCTGCTGCCCCGTGGGG - Intronic
1103567484 12:121823748-121823770 CTATATCCTGCTGGCATGGGGGG + Exonic
1104366181 12:128179656-128179678 CTCTCACCTGCTGCCACGTAAGG - Intergenic
1104513713 12:129404607-129404629 CCTTCTCCTGCTGCCATGATTGG - Intronic
1104630698 12:130399626-130399648 CTGTCCCGTTCTGCCATATGTGG - Intronic
1104898510 12:132175782-132175804 CTGCCTCCTCCTCCCGTGTGGGG - Intergenic
1104948424 12:132427708-132427730 CTGTTTTCAGCTGCCAAGTGTGG - Intergenic
1106319580 13:28625057-28625079 CTTTCTCCTTCTTCCAGGTGGGG - Intergenic
1106409147 13:29498994-29499016 CTGGCCCCTTCTGCCTTGTGAGG - Intronic
1106661052 13:31799884-31799906 ATGAGTTCTGCTGCCATGTGAGG - Intronic
1107360563 13:39613260-39613282 CTCGCTCCTTCTGCCATGTGAGG - Intergenic
1107603517 13:42037651-42037673 CTGACTCCTTCTGCCATGTGAGG - Intergenic
1107876083 13:44791570-44791592 CTGCTGCCTTCTGCCATGTGAGG + Intergenic
1108770840 13:53699002-53699024 CTCTCTCCTGCTGCCATGTAAGG + Intergenic
1108910314 13:55541983-55542005 CTGGCACCTTCTGTCATGTGAGG - Intergenic
1109030045 13:57179623-57179645 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1109119288 13:58433741-58433763 CTTCCTCCTTCTGCCATGTGAGG - Intergenic
1109221169 13:59642525-59642547 CTCTCTCCTGCCACCATGTGAGG - Intergenic
1109674954 13:65663457-65663479 CTCTTTTCTGCCGCCATGTGAGG + Intergenic
1109875901 13:68404571-68404593 CTCCTTGCTGCTGCCATGTGAGG - Intergenic
1109940740 13:69360720-69360742 CTCTCTCCTGCCACCATGTGAGG + Intergenic
1110048522 13:70861579-70861601 CTCTTGCCTGCTGCCATGTAAGG - Intergenic
1110484676 13:76024255-76024277 TTCTCTCTTCCTGCCATGTGAGG + Intergenic
1110542057 13:76717835-76717857 CTTTCTCCTTCTGCCATGATTGG - Intergenic
1110632130 13:77721232-77721254 CTCTCTCCTGCCACCATGTAAGG + Intronic
1110884504 13:80616567-80616589 CTCTCGCCTTCTGCCATGAGTGG + Intergenic
1111002648 13:82205540-82205562 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1111050782 13:82881464-82881486 CTTTCCCCTGCTACCTTGTGAGG + Intergenic
1111148266 13:84214283-84214305 CTTCCTGCTCCTGCCATGTGAGG + Intergenic
1111378910 13:87419935-87419957 CTTTTGCCTGCTGCCATGTAAGG - Intergenic
1111563673 13:89986288-89986310 CTGGCTCTTTCTGCCATTTGAGG + Intergenic
1111576393 13:90159840-90159862 CTCTTGCCTGCTGCCATGTAAGG + Intergenic
1111643172 13:90996581-90996603 CTGTCTCTGTCTGCCATGTGAGG - Intergenic
1111918247 13:94383873-94383895 CTCTCTCCTGCCACCTTGTGAGG - Intronic
1112119106 13:96390407-96390429 TTGTCTCCTTCTGCCACGTGAGG + Intronic
1112606736 13:100913705-100913727 CTTGCTCTTTCTGCCATGTGAGG + Intergenic
1112734961 13:102406151-102406173 TTGTCCCCTGCCACCATGTGAGG - Intergenic
1112789943 13:102992158-102992180 CTGACTCCCTCTGCCATGTGAGG - Intergenic
1113025085 13:105931327-105931349 CTCTCTCTTTCTGCCCTGTGAGG - Intergenic
1113221964 13:108114901-108114923 CTCTTGCCTGCTGCCATGTAAGG + Intergenic
1113413924 13:110113435-110113457 CTGGCTCCTGCTGTCTTATGAGG + Intergenic
1113653284 13:112053313-112053335 ATGCCTCCTGTTCCCATGTGCGG + Intergenic
1114281021 14:21192509-21192531 CTGCCTCCTGCTGTCATTTATGG - Intergenic
1114896563 14:26998023-26998045 CTATCCCCTTCTGACATGTGAGG + Intergenic
1115311381 14:31981975-31981997 CTCTCTCCTGCTGCCCTGTGAGG + Intergenic
1116000062 14:39233136-39233158 CTGTATACTTCTACCATGTGGGG + Intronic
1116334023 14:43634260-43634282 CTTTCACCTTCTGCTATGTGAGG - Intergenic
1116931765 14:50697627-50697649 CTCTCTCCTGCCACCATGTGAGG - Intergenic
1117051683 14:51866670-51866692 CTGGCCCCTTCTGTCATGTGGGG - Intronic
1117732082 14:58733228-58733250 TCTTCTCCTTCTGCCATGTGAGG - Intergenic
1117735184 14:58761798-58761820 CTCTTTCCTGCCGCCCTGTGAGG - Intergenic
1118050890 14:62026428-62026450 CTTCCACCTTCTGCCATGTGAGG - Intronic
1118374237 14:65162974-65162996 GTGTCTCCTTCTTGCATGTGAGG + Intergenic
1118437855 14:65787771-65787793 GTTTTTCCTTCTGCCATGTGAGG - Intergenic
1118484374 14:66200002-66200024 CTCTGTCCTGCTCCCTTGTGAGG + Intergenic
1118485164 14:66207593-66207615 CTCTCTCCTGCTGCCTTGTGAGG + Intergenic
1118682975 14:68262352-68262374 CTGTCACCTGCTACCTTGGGAGG + Intronic
1118783422 14:69025629-69025651 CTTGCTCCTCCTACCATGTGAGG - Intergenic
1119386953 14:74263385-74263407 CTGTTTCCTACTGCCCTCTGCGG + Intergenic
1119414269 14:74459193-74459215 CTGTCTCCTGCTGGTTTTTGAGG - Intergenic
1119537261 14:75412622-75412644 CTCTCTCCTTCTACCATGTGAGG + Intergenic
1119934149 14:78575101-78575123 CTGTCCCCTGCCGCCCTGTGAGG + Intronic
1120101692 14:80451672-80451694 CTCTGTCCTGTTGCCATGGGAGG + Intergenic
1120212116 14:81643450-81643472 CTCTCTCTCCCTGCCATGTGAGG + Intergenic
1120253863 14:82093142-82093164 CTCTCTCCTGCTGCCTAGTGAGG + Intergenic
1120330792 14:83090903-83090925 CTCACTCCTTCTGCCGTGTGCGG + Intergenic
1120391260 14:83911174-83911196 CTCTCTCCTGCCACCATGTGAGG + Intergenic
1120473109 14:84951623-84951645 TTCCCTCCTGCTGCCCTGTGAGG + Intergenic
1120566720 14:86068761-86068783 CTCACTCCTTCTGCCATGTGAGG - Intergenic
1120658894 14:87229823-87229845 TTCTCTCCTGTCGCCATGTGAGG - Intergenic
1121424240 14:93837106-93837128 CTTGCTCCTGCTGCCATGTGAGG - Intergenic
1121571546 14:94950197-94950219 CTTTCTCCCGCTGCCTTGTTGGG + Intergenic
1121846614 14:97177731-97177753 CTCCGTCCTGCTGCCCTGTGAGG - Intergenic
1122754891 14:103970494-103970516 GTGTTGCCTGATGCCATGTGGGG + Intronic
1122891066 14:104732494-104732516 CTGGCTCCTGCTCCCAGGGGTGG + Intronic
1123876297 15:24627180-24627202 CTTTTTCCTGCCACCATGTGAGG + Intergenic
1124592870 15:31068788-31068810 TTCTCTGCTTCTGCCATGTGAGG + Intronic
1124937543 15:34186783-34186805 CTGTCTCCCGCTGCCATTCATGG - Intronic
1125870724 15:43099437-43099459 TTGTCTCCTGCTGAAATGGGAGG - Intronic
1126200990 15:45985911-45985933 CTCTTTGCTGCTGCCATGTGAGG + Intergenic
1126858942 15:52865421-52865443 CTCTCATCTGCTGCCATGTGGGG - Intergenic
1127233808 15:57025220-57025242 CAGGCGCCTGCTACCATGTGCGG + Intronic
1127275119 15:57436524-57436546 CTGTCTTAAGCTGCTATGTGGGG + Intronic
1127856122 15:62955128-62955150 CTCTCGCCTGCTGCCCTGGGAGG - Intergenic
1128822808 15:70675864-70675886 CTTTCGCCTTCTGCCAGGTGAGG + Intronic
1129337734 15:74863561-74863583 CTGCCACCGGCTGCAATGTGTGG + Intronic
1129429231 15:75486394-75486416 CCTTCCCCTTCTGCCATGTGAGG + Intronic
1129504331 15:76068637-76068659 CTCTCTCCTGCTTCCATGTGAGG + Intronic
1129630010 15:77248560-77248582 CTTGCCCCTTCTGCCATGTGAGG + Intronic
1129759576 15:78121648-78121670 CTCTTTCCTGCCGCCATGTGAGG + Intronic
1129828319 15:78650311-78650333 CTGACTCCTGCTGTCATTTGTGG - Intronic
1131512589 15:93057426-93057448 CTCCCTCCTTCTGCCACGTGAGG + Intronic
1132014399 15:98302936-98302958 CTGTCTGCCAATGCCATGTGAGG + Intergenic
1132202263 15:99963161-99963183 CTGTCCCCAGCTGCCAGGAGTGG + Intergenic
1132337394 15:101057077-101057099 CTGGGACCTCCTGCCATGTGAGG + Intronic
1132613532 16:829245-829267 GTGCCTCCTGCTGCTGTGTGAGG + Intergenic
1132971771 16:2692748-2692770 CTGCCTCCTGCTGCCATACATGG + Intronic
1133100156 16:3474568-3474590 CGCCCTCCTGCTGCCATGGGTGG - Intronic
1133106631 16:3514717-3514739 CTCACCCCTGCTGCCATGTGAGG - Intronic
1133675865 16:8071223-8071245 CTCTCTCTTTCTGCCATGTGAGG - Intergenic
1133712529 16:8415132-8415154 CTATGTACTGCTGCCATGAGGGG - Intergenic
1134224073 16:12378241-12378263 CTGCCTTCTGCTGCCACGAGTGG - Intronic
1134327897 16:13223768-13223790 CTCTTGCCTGCTGCCATGTAAGG - Intronic
1134535054 16:15019637-15019659 CTCACCCCTTCTGCCATGTGAGG - Intronic
1134801716 16:17090744-17090766 CTCTTGCCTGCTGCCATGTAAGG + Intergenic
1134839446 16:17390068-17390090 CCCTCTCCTGCTGCTTTGTGAGG - Intronic
1135556446 16:23440919-23440941 CAGTCCCCTCCTGCCATGTGTGG - Intronic
1136390723 16:29962436-29962458 CCGCCTCCTGCTTCCAAGTGGGG - Intronic
1136714167 16:32263747-32263769 CTGTTTACTGCTGCGATGTGTGG + Intergenic
1136753732 16:32665671-32665693 CTGTTTACTGCTGCGATGTGTGG - Intergenic
1136814380 16:33204694-33204716 CTGTTTACTGCTGCGATGTGTGG + Intronic
1136820856 16:33314774-33314796 CTGTTTACTGCTGCGATGTGTGG + Intergenic
1136827419 16:33371313-33371335 CTGTTTACTGCTGCGATGTGTGG + Intergenic
1136832485 16:33470084-33470106 CTGTTTACTGCTGCGATGTGTGG + Intergenic
1137256357 16:46778341-46778363 CTGTCTCCTGCTGCCATTCATGG - Intronic
1137309373 16:47239040-47239062 TTGACCCCTTCTGCCATGTGAGG + Intronic
1137503318 16:49028445-49028467 CAGTTTCTTTCTGCCATGTGAGG + Intergenic
1137825290 16:51489581-51489603 CTGACTCCTGCTGCCATTCATGG + Intergenic
1138769557 16:59647859-59647881 CTCTCCCCTGCTGCCATGTGAGG - Intergenic
1138778185 16:59750704-59750726 CTCTCTTCTGCCGCCTTGTGAGG - Intronic
1139032027 16:62895683-62895705 CTTTCCCCTTCTGCCATGAGTGG + Intergenic
1139155993 16:64443195-64443217 CTTTCCCCTGCTGCCATGATTGG - Intergenic
1139401826 16:66688117-66688139 CTTGCTCATTCTGCCATGTGAGG - Intronic
1139860990 16:70021125-70021147 CTCACCCCTTCTGCCATGTGAGG + Intergenic
1140706872 16:77638966-77638988 CTGGCCCCTTCTGCCATGTGAGG + Intergenic
1140928726 16:79607623-79607645 CTGGTTCCTGCTGCCCTCTGAGG + Intergenic
1141058987 16:80846801-80846823 CTGCCTTCTCCTGCCATGTGAGG - Intergenic
1141229215 16:82149123-82149145 CTGTCTCAGGCTGCCAGTTGAGG - Intronic
1141757721 16:86003459-86003481 GTGGTTCCTTCTGCCATGTGAGG + Intergenic
1141986497 16:87583825-87583847 CTCTGTCCTGCTGCAGTGTGGGG + Intergenic
1142026783 16:87818667-87818689 CTGGCACCTGCTGCCATCTATGG + Intergenic
1142160818 16:88556489-88556511 CTCTCTCCTGCCGCCATGTGAGG + Intergenic
1142361801 16:89630904-89630926 CTGGCCCCTGCTGCTTTGTGGGG + Intronic
1202992956 16_KI270728v1_random:27668-27690 CTGTTTACTGCTGCGATGTGTGG + Intergenic
1203055887 16_KI270728v1_random:926022-926044 CTGTTTACTGCTGCGATGTGTGG - Intergenic
1142488373 17:261350-261372 CTCTCTCTCTCTGCCATGTGAGG + Intronic
1142507273 17:372528-372550 TTGGCCCCTCCTGCCATGTGAGG + Intronic
1142871371 17:2823263-2823285 CTGTGTCCTGGTGTCCTGTGGGG + Intronic
1143211868 17:5194015-5194037 CAGGCTCATGCTGCCATGCGCGG - Intergenic
1143463573 17:7120323-7120345 TTATCTCCTACTCCCATGTGAGG + Intergenic
1144060959 17:11583173-11583195 CTGCCTCCTGCTGCCATCCATGG + Intergenic
1144079114 17:11746285-11746307 CTCTTTCCTTCTGCCTTGTGAGG - Intronic
1144386266 17:14751496-14751518 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1144519886 17:15946289-15946311 TTATCTCCTGCTGCCCTGTTGGG + Intronic
1144599292 17:16598634-16598656 CCGTCTCCTTCCGCCATGAGTGG + Intergenic
1144948904 17:18983614-18983636 CAGGCTCCTGCTGCTATGTTGGG - Intronic
1145102542 17:20088905-20088927 CTTGCCCCTTCTGCCATGTGAGG + Intronic
1145378409 17:22373048-22373070 CTTCCGCCTTCTGCCATGTGAGG + Intergenic
1145831080 17:27916875-27916897 CTTTCTCCTGCCACCTTGTGAGG - Intergenic
1146472474 17:33135507-33135529 CTGTATCCCACTGCCCTGTGAGG + Intronic
1147648916 17:42050798-42050820 CTGGCTCCTGCTGCCGCGCGTGG - Intronic
1147900754 17:43782332-43782354 CTTTCTCCTTCTGCCCCGTGAGG - Intronic
1148086366 17:44996013-44996035 CTGTCTCTGGCTGCCCTGAGGGG + Intergenic
1148953515 17:51335147-51335169 CTAGCTCTTTCTGCCATGTGAGG - Intergenic
1149135677 17:53360447-53360469 CTCCCTCCTGCTGCCTTGTAAGG + Intergenic
1149723587 17:58869539-58869561 CCTTCTCCTTCTGCCATGGGTGG + Intronic
1150276088 17:63898780-63898802 CTCTTTCCTGCTGCCATCTCTGG - Intergenic
1150442815 17:65204690-65204712 CTGTCTACTGCTGCAGAGTGGGG - Intronic
1150486647 17:65548655-65548677 CTGTCTCCGGCTGTCCTTTGAGG - Intronic
1150796305 17:68240160-68240182 CTCACCCCTTCTGCCATGTGAGG - Intergenic
1151335845 17:73439194-73439216 CTTTCTCCTTCTGCCATGATTGG + Intronic
1151895375 17:76976911-76976933 CTCTCTCCTTCTGCCATGGGAGG - Intergenic
1152011291 17:77720029-77720051 CTCTCTCTTTCTGCCACGTGAGG - Intergenic
1152029545 17:77833473-77833495 CTTCCACCTTCTGCCATGTGAGG - Intergenic
1152263656 17:79280858-79280880 GGGTCTCCTGCAGGCATGTGGGG + Intronic
1152828994 17:82485897-82485919 CTCTCACCTGGTGCCATGTTGGG - Intronic
1152863441 17:82709168-82709190 CTGTCTCCTGCCCCCATGCCAGG + Intergenic
1152880346 17:82811176-82811198 CTGTCGCCTGGTGCCACCTGCGG + Intronic
1203160445 17_GL000205v2_random:44261-44283 CTGTCTCCTCCTGTTCTGTGTGG - Intergenic
1153222716 18:2875788-2875810 CTGTCTGCTGCAGCCAAGTTGGG + Intronic
1153518527 18:5929400-5929422 GTCTTTCCTTCTGCCATGTGAGG + Intergenic
1153711051 18:7799211-7799233 CTTCCTCCTTCTGCCATGTGAGG - Intronic
1153912211 18:9714245-9714267 CCGCCTCCTGCTCCCATCTGTGG - Intronic
1153967642 18:10196190-10196212 CTTGCTCCTTCTGCCACGTGAGG - Intergenic
1154343520 18:13523853-13523875 CTGTCTCCTGCTGCAAAGGGTGG - Intronic
1154355498 18:13620979-13621001 CTGTGTCCTGCTGGCCTCTGAGG + Intronic
1155233421 18:23796001-23796023 CTCTCTCCCTCTACCATGTGAGG + Intronic
1155694786 18:28672292-28672314 TTGTTTCCTTCTGCCATATGAGG - Intergenic
1155770685 18:29694597-29694619 CTGATTCCTTCTGCCATATGAGG + Intergenic
1156796611 18:41053600-41053622 CTCTCTCCTGCTGCTATGTAAGG + Intergenic
1156886244 18:42139675-42139697 CCTTCTGCTTCTGCCATGTGAGG - Intergenic
1157278111 18:46326675-46326697 CTGTCCACCGCAGCCATGTGTGG + Intergenic
1157389037 18:47285703-47285725 CTCTTTCCTGCTGCCTTGTGAGG + Intergenic
1157557246 18:48620937-48620959 CTGTCCCCTGCTTCCCAGTGGGG - Intronic
1157640412 18:49207129-49207151 CTGTCTGCTCCTGCTAGGTGAGG + Intronic
1157674417 18:49558466-49558488 CTCTCTCTCTCTGCCATGTGAGG + Intergenic
1157727125 18:49973314-49973336 CTGTCTCCGCATGCCACGTGGGG + Intronic
1157783720 18:50463542-50463564 CTTGCTCCTTCTACCATGTGAGG - Intergenic
1157818870 18:50750942-50750964 CTGGCTCCTTCCACCATGTGAGG + Intergenic
1158727743 18:59989652-59989674 CTCTCTCCTGCTGCCATGTAAGG + Intergenic
1159307548 18:66663987-66664009 CTCCTTCCTGCTGCCCTGTGAGG - Intergenic
1159424652 18:68269598-68269620 CTTCTTACTGCTGCCATGTGAGG + Intergenic
1159436848 18:68429253-68429275 CTCTCTCCTGCTGCCCTGTGAGG - Intergenic
1159780961 18:72659906-72659928 CTCCTTCCTGCTGCCTTGTGAGG - Intergenic
1159852920 18:73547727-73547749 CTCCTTCCTGCTGCCCTGTGAGG + Intergenic
1160251237 18:77204991-77205013 CTCCCTCCCGCTGCCATGTGCGG + Intergenic
1160281537 18:77495253-77495275 CTCTCTTCTGTTGCCTTGTGAGG + Intergenic
1160294813 18:77628239-77628261 CTCTTGCCTGCTGCCATGTAAGG - Intergenic
1160313100 18:77816095-77816117 CTTTCTCTTTCAGCCATGTGAGG - Intergenic
1160337868 18:78059009-78059031 CTGTCTCATGCCACCATGTTTGG - Intergenic
1160662337 19:306888-306910 CTGGCACCTGCTCCCATTTGTGG + Intronic
1160811873 19:1016326-1016348 CTGTCCCCAGATGCCATATGGGG - Intronic
1161173257 19:2824000-2824022 CTGCCTCCTGCTGCCATTCACGG + Intronic
1162126163 19:8500453-8500475 CTCCCTCCAGCTGCCATGGGGGG - Intronic
1162438878 19:10680612-10680634 CTTTCCCCTGGTGCCATGCGTGG + Intronic
1162473280 19:10885193-10885215 TTGTCCCCTGCTGCCAGGCGGGG + Intronic
1163381276 19:16970625-16970647 CTCACTCCTTCTGCCATATGAGG + Intronic
1163534913 19:17871688-17871710 CTGTCTGCTGTTGACAGGTGGGG - Intergenic
1163770229 19:19186577-19186599 CTCCTTCTTGCTGCCATGTGAGG + Intronic
1164576932 19:29410659-29410681 CTGTCCCCTCCTGCCCTGGGAGG - Intergenic
1165099337 19:33429215-33429237 CTTGCTCATGCTGCCATCTGTGG - Intronic
1165167275 19:33865689-33865711 CTTTTTCCTTCTGCCATGAGTGG - Intergenic
1165174501 19:33917700-33917722 CTGTCTCCTGCCGCCCTGTAGGG + Intergenic
1165401862 19:35606127-35606149 CTCCTTCCTGCTGCCATCTGAGG - Intergenic
1165600084 19:37047343-37047365 CTTCCTCCTTCTGCCATGTGAGG + Intronic
1165642251 19:37399680-37399702 CTTTTGCCTTCTGCCATGTGAGG - Intergenic
1165827486 19:38713599-38713621 CTGTCTCCAGGTGCCATGTGTGG + Intronic
1166814993 19:45539015-45539037 CTCCCTCCTGCTGCCTTGTGAGG - Intronic
1166862932 19:45820080-45820102 CTGGCTCCTGGTGGCCTGTGTGG + Intronic
1166897449 19:46032813-46032835 CTGCCTCCTGCTGCCATCCATGG - Intergenic
1166902671 19:46077728-46077750 CAGTCTCCTACTGCCATCTAGGG + Intergenic
1167013132 19:46821970-46821992 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1167178033 19:47879486-47879508 CTCCCTCCTGCCGCCTTGTGAGG - Intronic
1167235053 19:48309199-48309221 CTGCCTCCTGCTGCCATTCATGG - Intronic
1167283682 19:48586569-48586591 TTCTCCCCTGCTGCTATGTGTGG - Intronic
1168430068 19:56271663-56271685 CTCTCTCCTGCCGCCATCTCTGG - Intronic
925047848 2:788212-788234 CTCTCTCCTGCCACCTTGTGAGG - Intergenic
925637416 2:5953375-5953397 TTGTCTCCTGCTTCCTGGTGAGG - Intergenic
925703931 2:6666307-6666329 CTCTCTCCTGCTGCCATGTGAGG - Intergenic
925832767 2:7912353-7912375 CTCTGTCCTTCGGCCATGTGAGG - Intergenic
925853990 2:8111776-8111798 CTGTCTCTCTCTGCCATGTGAGG - Intergenic
925963129 2:9037669-9037691 CTCTTGCCTGCTGCCATGTAAGG - Intergenic
925994850 2:9283796-9283818 CTTTCTCTCGCTGCCATGTGAGG - Intronic
926111993 2:10189415-10189437 CTTGCTCCTCCTGCCCTGTGTGG - Intronic
926204822 2:10828598-10828620 CAGTCTCCTGCTAGCCTGTGCGG + Intronic
926242640 2:11100302-11100324 TTGTTTGCTGCTGCCCTGTGGGG + Intergenic
926628542 2:15116399-15116421 CTCTCTCTCTCTGCCATGTGGGG - Intergenic
926835733 2:17017982-17018004 CCTTCTCCTGCTGCCATGTGAGG - Intergenic
927072873 2:19548383-19548405 CTGCCTCCTGCTGCCATTGAAGG - Intergenic
927110883 2:19863116-19863138 CTCTCACCTGCGACCATGTGAGG - Intergenic
927410923 2:22825415-22825437 CTTTCCCCTGCTGCCATGAGTGG + Intergenic
927533887 2:23837027-23837049 CTGCCTCCTGCTGCCATTCATGG + Intronic
927871995 2:26629587-26629609 CTGTCTCCTGCTGCAAGGGGTGG + Intronic
928740060 2:34341123-34341145 CTCTTTCCTGCTGCCATGTAAGG - Intergenic
928825942 2:35421025-35421047 GTTTTTCCTTCTGCCATGTGAGG + Intergenic
929129037 2:38547963-38547985 CCTGCTCCTTCTGCCATGTGAGG + Intergenic
929278643 2:40053506-40053528 ATTTCACCTTCTGCCATGTGAGG + Intergenic
929584525 2:43105421-43105443 CTAACCCCTTCTGCCATGTGAGG + Intergenic
929794023 2:45044756-45044778 CTGTCTTTTGCTGCTATGTTGGG + Intergenic
929831124 2:45347350-45347372 CTTGCTCCTTCTGCCATGTGAGG - Intergenic
930203273 2:48564354-48564376 CACTCTCTTTCTGCCATGTGAGG - Intronic
930225141 2:48784658-48784680 CTGTCTTCTGCTGCTTTTTGAGG + Intergenic
930389707 2:50745700-50745722 CTGTCTCCTGCTGCCATGTGAGG - Intronic
930427703 2:51233295-51233317 TTCTCTCCTGCCACCATGTGAGG - Intergenic
930831667 2:55750159-55750181 CTTTCCCCTTCTGCCATGTGAGG + Intergenic
931119260 2:59198357-59198379 CTCCTTGCTGCTGCCATGTGAGG + Intergenic
931174555 2:59840143-59840165 CTCTTGCCTGCTGCCATGTAAGG + Intergenic
931996468 2:67843767-67843789 TTCTCTCCTGCTGACATGTGGGG - Intergenic
932294819 2:70615567-70615589 CTGCCTCCTCCTGCCATGTGAGG - Intronic
932369382 2:71174808-71174830 CTCTCTCTCTCTGCCATGTGAGG + Intergenic
932903151 2:75723333-75723355 CTGCCTGCAGCTGCCAGGTGGGG + Intergenic
933107914 2:78356719-78356741 TTGGCCCCTTCTGCCATGTGAGG - Intergenic
933465570 2:82646781-82646803 CTTTGTCATGTTGCCATGTGAGG - Intergenic
934103322 2:88673750-88673772 CTCTCTCCTGCCACCTTGTGAGG + Intergenic
934118394 2:88816707-88816729 CTCTCTCCTGTTGCCATGTAAGG + Intergenic
934539348 2:95161051-95161073 TTTGCTCCTCCTGCCATGTGAGG + Intronic
934984135 2:98871745-98871767 CTGTGTCCTGCTGCTGTGTCTGG - Intronic
935517990 2:104067604-104067626 CTCTGTCCTGCAGCCTTGTGAGG - Intergenic
935559152 2:104543234-104543256 CTCACCCCTGCTGCCACGTGAGG + Intergenic
935581945 2:104763527-104763549 CTCTCTCTCTCTGCCATGTGAGG + Intergenic
935708333 2:105875619-105875641 CTTGCTGCTTCTGCCATGTGAGG + Intronic
935716458 2:105943515-105943537 CTCGCCCCTTCTGCCATGTGAGG - Intergenic
935747003 2:106197218-106197240 CTCTCCCCTGCCGCCATATGAGG + Intergenic
935819725 2:106882835-106882857 CTGGCTTCTGCTGCCCTCTGTGG - Intronic
936161671 2:110088018-110088040 CTCACTCCTGCTGCCATGTAAGG + Intronic
936161946 2:110089984-110090006 ATCTCTCCTGCTGCCATGCAAGG + Intronic
936182717 2:110281370-110281392 ATCTCTCCTGCTGCCATGCAAGG - Intergenic
936182992 2:110283336-110283358 CTCACTCCTGCTGCCATGTAAGG - Intergenic
936392049 2:112084112-112084134 CAGGCTCCTGCTGCAATCTGAGG - Intronic
936472252 2:112809683-112809705 CTCTTTCCTGCTGCCATGTGAGG + Intergenic
936543129 2:113368280-113368302 CTCACCCCTTCTGCCATGTGAGG - Intergenic
936751496 2:115647735-115647757 CTTTCTCTTCCTACCATGTGAGG - Intronic
937013603 2:118583554-118583576 CTCACCCCTTCTGCCATGTGAGG - Intergenic
937570968 2:123360878-123360900 CTTTCTCATGCTGCCATGTCTGG + Intergenic
938095345 2:128457736-128457758 CTTTCTCTCTCTGCCATGTGAGG + Intergenic
938241309 2:129744419-129744441 CTGTCTCCTCCCGCTATGTGAGG - Intergenic
938687745 2:133756868-133756890 CTCCTTCCTGCTGTCATGTGAGG - Intergenic
938961486 2:136345510-136345532 CTTGCTCCTTCTGCCATGTGAGG - Intergenic
939098363 2:137863597-137863619 CTCTTTCCTGCTACCATGTGAGG + Intergenic
939119569 2:138100387-138100409 CAGGCTCCTTCTACCATGTGAGG - Intergenic
939461578 2:142503292-142503314 CTGTCTTCTGTTGCTATGTTAGG - Intergenic
939727454 2:145740553-145740575 CTCTCTCCTGCCACCATGTGAGG - Intergenic
940004810 2:149000758-149000780 CTGTCTCCTCCAGCCCTTTGAGG - Exonic
940191916 2:151050050-151050072 CTGTCTGTCTCTGCCATGTGAGG - Intergenic
940391263 2:153135165-153135187 CTCTATCTTTCTGCCATGTGAGG - Intergenic
940598161 2:155820463-155820485 CTCTCTCCTGCAACCATGTAAGG + Intergenic
940598665 2:155828697-155828719 CCTTCTCGTGCTGCCATGTAAGG - Intergenic
941055945 2:160788201-160788223 CTGCCTACTTCTGCCATGTGAGG + Intergenic
941097951 2:161262290-161262312 CTGTCCTCTTCTGCTATGTGAGG - Intergenic
941348840 2:164406128-164406150 CTTGCTCCTTCTGCCATGTGAGG + Intergenic
941392832 2:164935909-164935931 CTGTCTCTCTCTGCCATGTGAGG + Intronic
941400712 2:165026932-165026954 TTCTCTCCTGCCGCCCTGTGAGG - Intergenic
941429670 2:165398847-165398869 CCCTCTCCTGCTGCCATATAAGG - Intergenic
941478750 2:165979839-165979861 CTCACTCCTTCTGTCATGTGCGG + Intergenic
941992090 2:171567509-171567531 CTCTCTCCTGCTGCCATGTGAGG - Intergenic
942803143 2:179899047-179899069 CTCTCTCTCTCTGCCATGTGAGG - Intergenic
943023513 2:182602049-182602071 CTGCCTCCTGCTGCCATTCATGG + Intergenic
943104569 2:183528665-183528687 CTCTCTCCTGCCACCATGTGAGG + Intergenic
943222158 2:185123681-185123703 CTCTCTCCTGCCACCATATGAGG + Intergenic
943389322 2:187244053-187244075 CTCTCTCCTTCAGCCATGTGAGG - Intergenic
943505406 2:188750284-188750306 CCTGCTCCTCCTGCCATGTGAGG + Intronic
943592712 2:189818398-189818420 CTTCCTTCTTCTGCCATGTGAGG + Intronic
943848244 2:192679546-192679568 TTGTCTCCTACTGCCATGTAAGG + Intergenic
944103687 2:196056101-196056123 CTGTTTACTGCAGCCATGTCTGG - Intronic
944186858 2:196958614-196958636 CTCTCTCCTGCCACCATGTGAGG - Intergenic
944286225 2:197952830-197952852 CTCTTGCCTGCTGCCATGTAAGG + Intronic
944467608 2:200018792-200018814 CTTACCCCTTCTGCCATGTGAGG - Intergenic
945739365 2:213641883-213641905 CTATCTCCTGCTGCCTTGTGAGG - Intronic
945765386 2:213970063-213970085 TTTGCTCCTTCTGCCATGTGAGG - Intronic
945901114 2:215538773-215538795 CTCTGTCATGCTGTCATGTGAGG + Intergenic
946109394 2:217401121-217401143 TTGTCTCTGGCTTCCATGTGGGG + Intronic
946468930 2:219938538-219938560 CTTTCACCTTCTGCCAGGTGAGG + Intergenic
946576131 2:221077559-221077581 TTTTCTCCTGCTACCATGTGTGG + Intergenic
946637700 2:221747857-221747879 CTAGCCCCTTCTGCCATGTGAGG + Intergenic
946866737 2:224047651-224047673 CTTACTCCTCCTGCCATGTGAGG + Intergenic
947015277 2:225612669-225612691 CTTTCTCTGTCTGCCATGTGAGG - Intronic
947069820 2:226276188-226276210 CGTGCTCCTTCTGCCATGTGAGG - Intergenic
947108018 2:226688098-226688120 CTTTCTCCTCCCGTCATGTGAGG - Intergenic
947121802 2:226823163-226823185 TTTTGTCCTGCTGCTATGTGAGG + Intergenic
947358913 2:229326409-229326431 TTGTTCCCTACTGCCATGTGAGG + Intergenic
947409850 2:229825553-229825575 CTTTTTTCTGCTGCCCTGTGAGG - Intronic
947845135 2:233237707-233237729 CTTGCTCCTCCTACCATGTGAGG - Intronic
948270275 2:236668784-236668806 GTGTCCCCTGCTGCCTTCTGGGG + Intergenic
948385913 2:237580707-237580729 CTGTCTCCTGCTGCCCAGGCTGG - Intronic
1168918988 20:1515539-1515561 CTGTCTCCTGCAGCCACCAGAGG - Intergenic
1169844902 20:9979238-9979260 CTCTCTCCTGCCACCATGTGAGG + Intergenic
1169902476 20:10567404-10567426 CTTCCTCCTTCTGCCGTGTGAGG + Intronic
1170496351 20:16929075-16929097 CTCTCTCCTGCTGCCATGTGGGG + Intergenic
1170743572 20:19078893-19078915 CTAGCTCTTTCTGCCATGTGAGG + Intergenic
1170957048 20:20991166-20991188 CTCTCCCCTTCTGCCATGTGAGG - Intergenic
1171061583 20:21968671-21968693 CTTTCCCTTTCTGCCATGTGAGG + Intergenic
1171426070 20:25049500-25049522 CTGTCTCCTGCACCCATGGCAGG - Intronic
1171524868 20:25800942-25800964 CTTCCACCTTCTGCCATGTGAGG - Intronic
1171551959 20:26054941-26054963 CTTCCACCTTCTGCCATGTGAGG + Intergenic
1171793069 20:29546241-29546263 CTTCCGCCTTCTGCCATGTGAGG + Intergenic
1171855382 20:30338165-30338187 CTTCCGCCTTCTGCCATGTGAGG - Intergenic
1172314021 20:33939647-33939669 CTGTCTCCTGCCACCATGTGAGG + Intergenic
1172769914 20:37375912-37375934 CTGTCTCTCTCTGCCATGTGAGG - Intronic
1172867416 20:38110985-38111007 CTGCCACCTGCAGCCTTGTGTGG + Intronic
1173234173 20:41228571-41228593 CTGGTCCCTTCTGCCATGTGAGG - Intronic
1174086075 20:48008184-48008206 CTTGCTCCTGCTCCCACGTGAGG - Intergenic
1174118957 20:48248153-48248175 CTGTTTGTTGCTGCCATCTGTGG + Intergenic
1174146983 20:48459024-48459046 GTGTCTCCTGCTGCCAGGGTCGG - Intergenic
1174517767 20:51106297-51106319 CTTTCCCCTTCTGCCATGTGAGG + Intergenic
1174581759 20:51577179-51577201 CTATTTCCTGCTGAGATGTGAGG + Intergenic
1174706533 20:52662072-52662094 TTTTCCCCTTCTGCCATGTGAGG - Intergenic
1174949471 20:55028616-55028638 CTGTCTTTTGCTGCCAAGTTTGG + Intergenic
1175198574 20:57263388-57263410 CTTGCTCCTGCCGCCATGGGGGG + Intronic
1175546341 20:59780473-59780495 GTGGCCCCTTCTGCCATGTGAGG - Intronic
1175653109 20:60746037-60746059 CTCTCTCCTGTCACCATGTGAGG - Intergenic
1176307385 21:5130853-5130875 TTGTATCCTGCTGTCTTGTGGGG - Exonic
1176408372 21:6434192-6434214 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1177006243 21:15675866-15675888 CTCACCCCTTCTGCCATGTGAGG + Intergenic
1177052426 21:16253815-16253837 CTCTCTCCTGCCACCATGTAAGG - Intergenic
1177291387 21:19118254-19118276 CTCTCTCCTGCCACCTTGTGAGG - Intergenic
1177624884 21:23646664-23646686 CTGTCTCCGGCTGCCATCCCTGG + Intergenic
1178071407 21:28972146-28972168 TTTACTCCTTCTGCCATGTGAGG + Intronic
1178231455 21:30789742-30789764 CTCTCTCCCTTTGCCATGTGGGG + Intergenic
1178631489 21:34265092-34265114 CTTTCTCCTTCCTCCATGTGAGG + Intergenic
1179158445 21:38872475-38872497 CTCTCTCCTGCCACCTTGTGAGG + Intergenic
1179357237 21:40672045-40672067 CTTTCTCTCTCTGCCATGTGAGG - Intronic
1179628799 21:42664250-42664272 CTGTGTCATGCTGCGAGGTGAGG - Intronic
1179849675 21:44131177-44131199 TTGTATCCTGCTGTCTTGTGGGG + Exonic
1180840496 22:18956821-18956843 CAGCCCCCTCCTGCCATGTGGGG + Intergenic
1181060992 22:20281953-20281975 CAGCCCCCTGCTGCCATGTGGGG - Intronic
1181920079 22:26313751-26313773 CTGTCTTTTACAGCCATGTGTGG + Exonic
1182429188 22:30290090-30290112 CTGCCCCCTGCAGCCATGAGAGG - Intronic
1182920539 22:34075214-34075236 CTTCCCCCTTCTGCCATGTGAGG - Intergenic
1182941645 22:34282701-34282723 CTGCTTGCTGCTGCCATGTGAGG - Intergenic
1183012393 22:34957589-34957611 CTCACTCCTTCTGCCATGTGAGG - Intergenic
1183300166 22:37055063-37055085 CCCTCTCTTTCTGCCATGTGAGG - Intronic
1184479298 22:44737617-44737639 CTGTCTCCTCCTGCCTGGGGTGG + Exonic
1184560927 22:45262582-45262604 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1184665661 22:45987623-45987645 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1185175968 22:49326908-49326930 CTCTCTCTCTCTGCCATGTGAGG + Intergenic
1185198216 22:49485926-49485948 CTGTCTGTCTCTGCCATGTGAGG + Intronic
949404571 3:3700924-3700946 CTCTCTCCTGCCGCCATGTGAGG - Intronic
949474062 3:4425872-4425894 CTCTTGCCTGCTGCCATGTAAGG - Intronic
949497815 3:4649814-4649836 CCCTCTCTTTCTGCCATGTGAGG - Intronic
949825193 3:8157555-8157577 GGGTCAGCTGCTGCCATGTGGGG - Intergenic
949840535 3:8315299-8315321 TTGTCTCCTGATTCCATGAGTGG - Intergenic
950567374 3:13778291-13778313 CTGGCCCCTTATGCCATGTGAGG + Intergenic
951061693 3:18215829-18215851 CTTTCTCTTTCTGTCATGTGAGG + Intronic
951093771 3:18604507-18604529 ACTTCTCCTTCTGCCATGTGAGG - Intergenic
951706617 3:25550464-25550486 CTTCCCCCTTCTGCCATGTGAGG - Intronic
951778221 3:26333989-26334011 CTCTTGCCTGCTGCCATGTAAGG + Intergenic
951798248 3:26566481-26566503 CTGCCTCCTGCTGCCATTCATGG + Intergenic
952269417 3:31817268-31817290 CTCTCTCCTGCTGCCATTCAGGG + Intronic
952834776 3:37593546-37593568 CTCTCTCTCCCTGCCATGTGAGG - Intronic
953244005 3:41174658-41174680 TTGTCTCCTGCTGACAGCTGGGG + Intergenic
953408398 3:42672184-42672206 TTGGCTCCTTCTGCCATATGCGG + Intergenic
953408560 3:42673505-42673527 CTTTGGCCTTCTGCCATGTGAGG - Intergenic
953467574 3:43136972-43136994 CTCTGCCCTTCTGCCATGTGAGG - Intergenic
953847397 3:46438597-46438619 CTGTCCCAGGCTCCCATGTGGGG + Intronic
954036777 3:47855023-47855045 CTGCCTCCAGCTGACAGGTGAGG + Intronic
954611686 3:51947680-51947702 CTGCCTCCTGCTGACCTGTGGGG - Intronic
954625564 3:52020217-52020239 CTGTCACCTCCTGCCAGGAGGGG + Intergenic
955241647 3:57183240-57183262 CTTTCCCCTTCTGCCATGTGAGG - Intergenic
955466597 3:59243420-59243442 CTCACTCCTTCTGCCTTGTGAGG + Intergenic
955480416 3:59384284-59384306 CAGACTCCTGCTGCAATGTATGG - Intergenic
955566243 3:60249895-60249917 CTCCTTCCTGCTGCCATGTAAGG - Intronic
955754504 3:62214232-62214254 CCATCTCCTGCTGCTGTGTGAGG + Intronic
956367378 3:68519252-68519274 TTGTCTCTTTCTGCCATGTAAGG + Intronic
956758359 3:72412961-72412983 CTTCCACCTTCTGCCATGTGAGG + Intronic
956820829 3:72952704-72952726 CTCTCTCTCTCTGCCATGTGAGG - Intronic
957016558 3:75070421-75070443 TTTGCTCCTTCTGCCATGTGAGG + Intergenic
957159271 3:76587477-76587499 CTCCGTCCTGCTGGCATGTGAGG - Intronic
957638325 3:82815603-82815625 CTGCCTCCTGCTGCCATTGATGG + Intergenic
957922441 3:86762962-86762984 GTGTCTCTTGCTGACATGTAAGG - Intergenic
957923050 3:86772101-86772123 CTGTCTCCTGCTGCCATCTATGG - Intergenic
958471819 3:94531117-94531139 CTCTCTCCTGCCACCCTGTGAGG - Intergenic
959407251 3:105975534-105975556 CTGTGCCCTCCTACCATGTGAGG + Intergenic
959517531 3:107286125-107286147 CTCTCTCCTTCTACCATGTAAGG + Intergenic
959723239 3:109515628-109515650 CTCTCTCTCTCTGCCATGTGAGG - Intergenic
959781824 3:110243092-110243114 TTTGCTCCTTCTGCCATGTGAGG - Intergenic
960358431 3:116680632-116680654 CTCTTGCCTTCTGCCATGTGAGG + Intronic
960517810 3:118621477-118621499 CTGTTTCCTGCCGCCTTGGGAGG + Intergenic
960895324 3:122498328-122498350 CTTGCTCCTTCAGCCATGTGAGG + Intronic
961330196 3:126133902-126133924 CCGTATCCAGCTGCCAAGTGGGG - Intronic
961479345 3:127169813-127169835 CTTTCGCCTTCTGCCATGAGTGG + Intergenic
961646361 3:128394824-128394846 CTGTCCTCTGCTCCCCTGTGGGG - Intronic
961902502 3:130226671-130226693 AGCTCTCCTTCTGCCATGTGAGG - Intergenic
962105271 3:132383030-132383052 CTGCCTCCTGCTGCCATTCATGG + Intergenic
962635068 3:137322862-137322884 CTTTCTCCTGCTGTTATGTGAGG - Intergenic
962892064 3:139680564-139680586 CTGTCTCCTGCAGCCTTGGGTGG - Intergenic
962970575 3:140397620-140397642 CTGTCCTCTTCAGCCATGTGAGG - Intronic
963262931 3:143211058-143211080 CTTTCTCCTTCTGACATGAGTGG - Intergenic
963530969 3:146472938-146472960 CTTTCTCTCTCTGCCATGTGAGG - Intronic
963845466 3:150151430-150151452 CTCTCTCTTTCTGTCATGTGAGG + Intergenic
963850894 3:150209404-150209426 CTCTGTCTTGCTGCCGTGTGAGG + Intergenic
964178436 3:153854857-153854879 CTCTCTCTGTCTGCCATGTGAGG + Intergenic
964233123 3:154493663-154493685 CTGTCTTTCTCTGCCATGTGAGG + Intergenic
964255077 3:154766626-154766648 CTGTGTCCTGCTGCCATTTATGG + Intergenic
964675879 3:159279279-159279301 CTCTTGCCTGCTGCCATGTAAGG + Intronic
964791845 3:160460344-160460366 CTGCCTCCTTCTGCCATTTATGG + Intronic
964848549 3:161069548-161069570 CTGTCTCCTGCAGCACTGGGTGG - Exonic
965169743 3:165247569-165247591 CTCTCTCCTGCTGCCAGGTAAGG - Intergenic
965201165 3:165659390-165659412 TTGTCTACTTCTGCCATGTGAGG - Intergenic
965443458 3:168745613-168745635 CTCTCTCCTTCCACCATGTGAGG - Intergenic
965455737 3:168897488-168897510 CTCTCTCCTGTTGCCATGTGAGG - Intergenic
965531858 3:169778334-169778356 TTTTCTCCTGCTCCCCTGTGAGG - Intronic
965797565 3:172457249-172457271 CTCACCCCTTCTGCCATGTGAGG - Intergenic
966288752 3:178329587-178329609 CTCTGCCCTTCTGCCATGTGAGG - Intergenic
966490593 3:180524125-180524147 CTGTCTCCTGTCTCCATGTGAGG - Intergenic
966972672 3:185059949-185059971 CTCTCTCCTGCCGCCATGTGAGG + Intergenic
967191971 3:186992292-186992314 CTTCCTCCTGCTGCCTTGTGAGG + Intronic
967315487 3:188148812-188148834 CTGCCTCCTGTTGCCACATGAGG - Intergenic
967646881 3:191935471-191935493 CCTTCTCCTTCTGCCATGAGTGG + Intergenic
967815561 3:193795610-193795632 GTGTCTCCCACTGCCATTTGAGG + Intergenic
967854480 3:194106371-194106393 CTCTCTCTCTCTGCCATGTGAGG - Intergenic
968095817 3:195929755-195929777 CTCCCTCCCTCTGCCATGTGAGG + Intergenic
968495302 4:912057-912079 CTGCCTCCTCCTGCCACGCGCGG - Intronic
968757881 4:2426220-2426242 CTGTCTCCTGCAGGCCTCTGCGG - Intronic
969189305 4:5504096-5504118 CTGGCTCCTTCTACCATGTGAGG + Intergenic
969194153 4:5547350-5547372 CTGCCTCCTGCTGCCATTCATGG - Intronic
969242869 4:5912684-5912706 CTGCCTCCTGCTTCCCTCTGTGG - Intronic
969355866 4:6625264-6625286 CTTGCCCCTTCTGCCATGTGAGG - Intergenic
969663470 4:8543849-8543871 CTTCCTCCTGCCGCCTTGTGAGG + Intergenic
969719246 4:8884048-8884070 TTTTGTCCTTCTGCCATGTGAGG + Intergenic
969908211 4:10417385-10417407 CTCTTTGCTGCTGCCATGTGAGG - Intergenic
970351685 4:15207706-15207728 CTCTCTCCTGCTGCCCTGTGAGG + Intergenic
970449797 4:16155643-16155665 CTGTTTCCTGCTGCTCGGTGGGG + Intergenic
970568155 4:17352630-17352652 GTGTCTCCTTTTACCATGTGAGG + Intergenic
970672245 4:18410336-18410358 ATCTCTCCTGCTGCCATGTAAGG + Intergenic
970896588 4:21110744-21110766 CTCTCTCCTTCCACCATGTGAGG + Intronic
970914575 4:21317862-21317884 CTCTTGTCTGCTGCCATGTGAGG + Intronic
971047179 4:22817784-22817806 CTGGCCCCTTCTGCCATATGAGG + Intergenic
971224491 4:24738323-24738345 CTCTCTCCTGCTGCCATGTGAGG + Intergenic
971895359 4:32586211-32586233 CTGGCTCCTCCTGTCATGTGTGG + Intergenic
971945672 4:33273531-33273553 CTTCCACCTTCTGCCATGTGAGG + Intergenic
972012979 4:34207025-34207047 CTGTCTCCTGCTGTCCTGTGAGG + Intergenic
972092640 4:35306961-35306983 CTCTCTCTCTCTGCCATGTGAGG + Intergenic
972261795 4:37416116-37416138 ACTTCTCCTGCTGCCTTGTGGGG - Intronic
972420121 4:38879121-38879143 CTTTCACCTCCAGCCATGTGGGG + Intronic
972469965 4:39394908-39394930 CACTCTCTTTCTGCCATGTGAGG - Intergenic
972667646 4:41182734-41182756 CTCCTTCCTGCTGCCTTGTGAGG - Intronic
972708047 4:41564903-41564925 CTCTCTCCTACTGCCCTGTGAGG + Intronic
972788153 4:42346383-42346405 CTGCCTCCTGCTGCCATCATGGG - Intergenic
972823463 4:42729276-42729298 CTCTCTCCTGCTGCCTTGTGAGG - Intergenic
973290209 4:48463604-48463626 CTCACTCTTTCTGCCATGTGCGG - Intergenic
973627284 4:52785426-52785448 CTGGCCCCTTCTGCCATGTGAGG + Intergenic
973815654 4:54616768-54616790 CTCTCTCTCCCTGCCATGTGAGG + Intergenic
973870750 4:55163728-55163750 CTGTCAGCCACTGCCATGTGTGG - Intergenic
974153664 4:58043320-58043342 CTTTTGCCTGCTGCCATGTAGGG + Intergenic
974202036 4:58655158-58655180 CTGGCCCCTTCTGCCATGTGAGG - Intergenic
974260168 4:59517221-59517243 ATGCCTGCTGCTGCCATGGGTGG + Intergenic
974308819 4:60176560-60176582 CTTCCTCCTTCTTCCATGTGAGG + Intergenic
974525175 4:63042281-63042303 CTCTCTCTTGCTGCCCTATGAGG - Intergenic
974644219 4:64671689-64671711 CTGGCACCTGCTGCCATTTATGG + Intergenic
974663999 4:64934920-64934942 CTGACCCCTGCTGCCAAGTCAGG - Intergenic
976074683 4:81284417-81284439 CCTTCTCCTTCTGCCGTGTGAGG - Intergenic
976425731 4:84901076-84901098 CTTTCGCCTTCTGCCATGTGAGG - Intronic
976738917 4:88338927-88338949 TTTGCCCCTGCTGCCATGTGGGG - Intergenic
977366108 4:96069420-96069442 CTCTTGCCTGCTGCCATGTAAGG - Intergenic
977490703 4:97706421-97706443 CTTTGCCCTTCTGCCATGTGAGG + Intronic
977748464 4:100579858-100579880 CTTGCCCCTTCTGCCATGTGAGG + Intronic
977748601 4:100581003-100581025 CTTGCTCCTTCTGCCATGTGAGG + Intronic
978229939 4:106385999-106386021 CTGCCTCCTGCTGCCATCCATGG + Intergenic
978365304 4:107974975-107974997 CTCTTTCCTGCTGCCTTGTGAGG + Intergenic
978623375 4:110656759-110656781 CTGTCTCCTGCTGCTCTGAGTGG - Intergenic
978827872 4:113046551-113046573 TTCTTTCCTTCTGCCATGTGAGG + Intronic
979060759 4:116058296-116058318 CTCTCTCCTGCTGCCATGTGAGG - Intergenic
979174391 4:117644496-117644518 CTTGCCCCTTCTGCCATGTGAGG - Intergenic
979181638 4:117736033-117736055 CTCTCTCCTGCCACCATGTAAGG - Intergenic
979509632 4:121537635-121537657 CTCTCTCTCTCTGCCATGTGAGG + Intergenic
979560472 4:122096239-122096261 CTCTTGCCTGCTGCCATGTAAGG - Intergenic
979727089 4:123975046-123975068 CTGGCTCCTTCCACCATGTGAGG + Intergenic
979739983 4:124137583-124137605 TTTCCTCCTGCTGCCATGTAAGG + Intergenic
979863162 4:125720001-125720023 CTCTCTCCTGCTGTCTGGTGTGG + Intergenic
980081342 4:128347685-128347707 TTGTCTCCTGTTTCCATCTGGGG - Intergenic
980127336 4:128786646-128786668 CTGTCTCTAGCTGCCTTGCGAGG + Intergenic
980174845 4:129332203-129332225 CTCACCCCTTCTGCCATGTGAGG + Intergenic
980310974 4:131128415-131128437 CTTCCTCCTTCGGCCATGTGAGG + Intergenic
980367201 4:131819400-131819422 CTCTCTTTTTCTGCCATGTGTGG + Intergenic
980414879 4:132473532-132473554 CTTTGTCCTTCTGCCATGAGAGG - Intergenic
980738250 4:136918120-136918142 CTGCCTCCTGCTGCCATTCCTGG - Intergenic
980892359 4:138829462-138829484 CTGTCTCCTTCTTCCCAGTGGGG + Intergenic
981052372 4:140321983-140322005 CTTCCACCTCCTGCCATGTGAGG + Intronic
981274989 4:142888737-142888759 CTTGCCCCTTCTGCCATGTGAGG + Intergenic
981356239 4:143792531-143792553 CTTCCTCCTTCTGCCATGTGAGG + Intergenic
981367766 4:143923165-143923187 CTTCCTTCTTCTGCCATGTGAGG + Intergenic
981377557 4:144033413-144033435 CTTCCTCCTTCTGCCATGTGAGG + Intergenic
981422159 4:144563583-144563605 TTTTGTCCTTCTGCCATGTGAGG - Intergenic
981698359 4:147581524-147581546 CTTCCACCTTCTGCCATGTGAGG + Intergenic
982075878 4:151736863-151736885 CTCTTGTCTGCTGCCATGTGAGG + Intronic
982113459 4:152077091-152077113 CTGGTCCCTTCTGCCATGTGAGG + Intergenic
982177016 4:152715406-152715428 CTCTCTCCTGCTGCCATGTGAGG + Intronic
982338872 4:154272591-154272613 CTCTCACCTACTGCCATGTAAGG + Intronic
982382112 4:154760376-154760398 CTCTCTCTCCCTGCCATGTGAGG + Intergenic
982832727 4:160084661-160084683 TTTCCTCCTTCTGCCATGTGAGG - Intergenic
982987900 4:162233428-162233450 CTCCATCCTGCTGCCTTGTGAGG - Intergenic
983132974 4:164044370-164044392 CTCTCTCCTGCCACCACGTGAGG - Intronic
983367245 4:166808460-166808482 CTCTCTCTCTCTGCCATGTGAGG + Intronic
983435107 4:167704245-167704267 CTGTCTACTGCAGCAATGTCTGG + Intergenic
983500636 4:168495391-168495413 CTTCCACCTTCTGCCATGTGAGG + Intronic
983812372 4:172078309-172078331 CTCTCTCCTGTCACCATGTGTGG + Intronic
983969268 4:173851170-173851192 TTGCCCCCTCCTGCCATGTGTGG + Intergenic
983975768 4:173932130-173932152 CCGTCTCCTGCAGACCTGTGTGG + Intergenic
984355812 4:178655565-178655587 CTCTCATCTGCTGCCATGTAAGG + Intergenic
984388722 4:179099654-179099676 CTCCCTCCTGCTGCCTTGTGAGG - Intergenic
984435961 4:179710426-179710448 CTTGCCCCTTCTGCCATGTGAGG - Intergenic
984633226 4:182082249-182082271 CTTGCTCTTTCTGCCATGTGAGG - Intergenic
984771884 4:183444009-183444031 CTGTCTACTGCTGCTATGTAAGG + Intergenic
984863384 4:184259181-184259203 CTTGCCCCTTCTGCCATGTGAGG + Intergenic
984876779 4:184375838-184375860 CTCTCTCCTGCCACCATGTCAGG - Intergenic
984891023 4:184493003-184493025 CTCTCTCCTGCTGCCATGTAAGG + Intergenic
984983195 4:185302622-185302644 CTTGCACCTTCTGCCATGTGAGG + Intronic
985371610 4:189291293-189291315 CTCTCTTCTGCTCCCATGTAAGG + Intergenic
985411907 4:189694402-189694424 GAGTCTACTGCTGCCATATGAGG + Intergenic
985710951 5:1429652-1429674 CTGCCAAGTGCTGCCATGTGGGG - Intronic
986215118 5:5712765-5712787 CTGCCTCCCACTGCCATTTGTGG + Intergenic
986269278 5:6217299-6217321 CTGCCTGCTGCTCCCCTGTGGGG + Intergenic
986275966 5:6275186-6275208 CTGTCTCAGGCTGTCATGTGGGG - Intergenic
986402176 5:7393563-7393585 CTGTCTCCTTCTTCCTAGTGGGG - Intergenic
986436288 5:7734926-7734948 CTATTTCTTTCTGCCATGTGAGG - Intronic
986625966 5:9723994-9724016 CTTTCTCCTGTTGGGATGTGGGG + Intergenic
986670663 5:10140160-10140182 CAGTCTCCTTCCACCATGTGAGG + Intergenic
986832740 5:11598983-11599005 CTTTCTCCTGCTGCCATGTAAGG - Intronic
987194902 5:15516813-15516835 CTCCTTGCTGCTGCCATGTGAGG + Intronic
987707198 5:21472149-21472171 CTCTTGCCTGCTGCCATGTAAGG - Intergenic
988236658 5:28554494-28554516 GTGTATCCTGCAGCCATTTGAGG + Intergenic
988442978 5:31253135-31253157 CTGACCCCTTCTGGCATGTGAGG - Intronic
988545765 5:32156097-32156119 CTATGCCCTTCTGCCATGTGAGG + Intronic
989520635 5:42396460-42396482 CTGCCTCTTGCTGCCATTTATGG - Intergenic
989752805 5:44916015-44916037 CTTTCTCCTCCTGCCATGGGTGG + Intergenic
989753782 5:44926217-44926239 CTGGCCCTTTCTGCCATGTGAGG + Intergenic
990181148 5:53162210-53162232 CTCTCTCTCTCTGCCATGTGAGG - Intergenic
990283790 5:54279438-54279460 CTCTCTCTGTCTGCCATGTGAGG - Intronic
990500883 5:56396274-56396296 CTGGCCCCTTCTGACATGTGAGG - Intergenic
990845219 5:60130038-60130060 TTGTCTCCTTCCACCATGTGAGG + Intronic
990849269 5:60183088-60183110 CTTTCTCTCTCTGCCATGTGAGG + Intronic
990947790 5:61267269-61267291 CTCTCTTCTGCTGCCATGTGAGG + Intergenic
991194479 5:63916669-63916691 CTTTCACCTTCTGCCATGTGAGG + Intergenic
991221527 5:64224901-64224923 CTTCCACCTTCTGCCATGTGAGG + Intronic
991300087 5:65121545-65121567 CTTGCTCCTTCTGCCAAGTGAGG - Intergenic
991357516 5:65784533-65784555 CTTCCCCCTTCTGCCATGTGAGG - Intronic
991633218 5:68677814-68677836 CTCACCCCTTCTGCCATGTGAGG + Intergenic
991651912 5:68864218-68864240 CCTTTTTCTGCTGCCATGTGTGG + Intergenic
992157933 5:73973073-73973095 CTTGCCCCTTCTGCCATGTGAGG - Intergenic
992161758 5:74011229-74011251 CTCTCTCTCTCTGCCATGTGAGG - Intergenic
992181928 5:74205872-74205894 CTCTCTCTCTCTGCCATGTGAGG + Intergenic
992578091 5:78140524-78140546 CTTGCTGCTTCTGCCATGTGAGG - Intronic
992598047 5:78366096-78366118 CCATCCCCTTCTGCCATGTGAGG - Intronic
992693157 5:79259519-79259541 CTGCCTCCTGCTGCCATTTATGG + Intronic
993594540 5:89836031-89836053 CTTCCTCCTGCCGCCTTGTGAGG + Intergenic
993748292 5:91630240-91630262 CTTTCACCCTCTGCCATGTGAGG + Intergenic
993787421 5:92160345-92160367 CTCTTTCCTGCTGCCATGTGAGG + Intergenic
993921686 5:93812988-93813010 CTCACTCTTTCTGCCATGTGAGG + Intronic
994015747 5:94962987-94963009 CTTTCACCTTTTGCCATGTGAGG - Intronic
994117552 5:96078090-96078112 CTCTCTCCCTCTGCCATGTGAGG - Intergenic
994665931 5:102705238-102705260 CTTCCTCCTTCTGCCATATGAGG + Intergenic
995027346 5:107439220-107439242 CATTCTCCTTCTGCCATGTGAGG + Intronic
995088779 5:108147028-108147050 CTGTCCCCTTCCACCATGTGAGG - Intronic
995089216 5:108153060-108153082 CTCTTTCCTGCTGCCATGTAAGG + Intronic
995136986 5:108689679-108689701 CTGTCTCTCTCTGCCATATGAGG + Intergenic
995343900 5:111090342-111090364 CTGTGCCCTGCTGCCATAGGTGG + Intergenic
995514093 5:112937114-112937136 CTCCCACCTTCTGCCATGTGGGG + Intergenic
995593059 5:113719788-113719810 CTTTTACCTTCTGCCATGTGAGG + Intergenic
995755485 5:115499196-115499218 CTCACCCCTTCTGCCATGTGAGG - Intergenic
995872171 5:116755234-116755256 CTCCCTCCTGCTGCCCTGTGAGG + Intergenic
995921725 5:117322308-117322330 CTATCTCCTTCCACCATGTGGGG + Intergenic
996182192 5:120432578-120432600 CTTCCACCTTCTGCCATGTGAGG + Intergenic
996227755 5:121022208-121022230 CTGTCTCTGTCTACCATGTGAGG - Intergenic
996369572 5:122739013-122739035 CTCTCTCTGTCTGCCATGTGAGG - Intergenic
996552444 5:124744613-124744635 CTGCCTTCTGCTGCCTTGTATGG - Exonic
996643695 5:125790216-125790238 CCTTCTCCTTCAGCCATGTGAGG + Intergenic
996849596 5:127937478-127937500 CTCTCTCTTTCTGCCATGTGAGG + Intergenic
996851867 5:127962099-127962121 CTTTCTCTCTCTGCCATGTGAGG - Intergenic
997861861 5:137425350-137425372 TTATCTCCTGCTCCCATGTGTGG + Intronic
997934042 5:138095387-138095409 CTGGCTCCTGCTGATTTGTGGGG + Intergenic
998195482 5:140066049-140066071 TTCTCTCCTTCTGCCATGTGAGG + Intergenic
998435068 5:142101125-142101147 CTCCTTCCTGCTGCCTTGTGGGG - Intergenic
998788398 5:145737905-145737927 GTATCTCCTTCTGCCAGGTGGGG - Intronic
998792242 5:145777942-145777964 CTGCCTCCTGCTGCCATTCATGG - Intronic
998980688 5:147698666-147698688 CTCTCTCCTGCTGCCTTGTGAGG + Intronic
999295691 5:150458310-150458332 CTGTCTCCTACTCCCATTTTGGG - Intergenic
999392696 5:151205744-151205766 CTGGCTCCTGCTGCCATCCCTGG + Intronic
999764286 5:154726841-154726863 CTCTCTCCTGCTGCCCTGTACGG - Intronic
999859881 5:155633715-155633737 CTGCCTCCTGCTGCCATTCAAGG - Intergenic
1000341452 5:160280125-160280147 CTGTCTCCTGCTTCCTGGTATGG - Intronic
1001361663 5:171091769-171091791 CTCTTGCCTGCTACCATGTGAGG + Intronic
1001710797 5:173776332-173776354 CTGGCCTCTTCTGCCATGTGAGG + Intergenic
1001814269 5:174654922-174654944 CTTCCGCCTTCTGCCATGTGAGG + Intergenic
1001947234 5:175789839-175789861 CTTCCACCTTCTGCCATGTGAGG + Intergenic
1001957882 5:175860783-175860805 CTATGTCCTACTGCCATGGGTGG - Intronic
1002356358 5:178632509-178632531 CTCTCCCCTGTTGCCTTGTGAGG - Intergenic
1002781421 6:369761-369783 CTGTGGCTTGCTGCCCTGTGAGG + Intergenic
1003003675 6:2360940-2360962 TTGTCTCTCTCTGCCATGTGAGG - Intergenic
1003103361 6:3194581-3194603 TTATCTCCTGCTTACATGTGAGG + Intergenic
1003183466 6:3811134-3811156 CTTTCACCTTCTCCCATGTGAGG + Intergenic
1003229899 6:4242664-4242686 CTCTCTCCAGCTGCCTTGTGAGG - Intergenic
1003320140 6:5043977-5043999 CTGCCTCCTGCTTCCCTGTGCGG + Intergenic
1003846896 6:10183099-10183121 CTATCTCCTTCCACCATGTGAGG + Intronic
1003896838 6:10615968-10615990 CTGTCTCATCCTGCTATGTCTGG + Intronic
1004003415 6:11616438-11616460 CTGAGTCCTGCTGCCAGGAGGGG + Intergenic
1004011908 6:11697180-11697202 CTCTTGTCTGCTGCCATGTGAGG + Intergenic
1004238453 6:13896742-13896764 CTTCTTGCTGCTGCCATGTGAGG - Intergenic
1005064272 6:21803378-21803400 CAGGCTCCTGCCACCATGTGTGG + Intergenic
1005138714 6:22601559-22601581 CTCTTGCCTGCTGCCATGTAAGG + Intergenic
1005161166 6:22865741-22865763 CTGTCTCACTCTGCCATTTGAGG - Intergenic
1005234608 6:23745210-23745232 CTGGCTCTTTCTGCCATGTGAGG + Intergenic
1005252327 6:23961831-23961853 CTTTTTCCTGCTGCTTTGTGAGG - Intergenic
1005256739 6:24011332-24011354 CTCTCTCCTGCCACCATGTGAGG + Intergenic
1005389114 6:25315466-25315488 CTGGCACCTGCCGCCATGTGTGG - Intronic
1006507041 6:34496038-34496060 CTGCCTGCTGCTCCCCTGTGTGG + Intronic
1006670869 6:35728938-35728960 CTGTCTCCTGGCGTCTTGTGGGG + Intergenic
1006698097 6:35948914-35948936 CTTCCACCTTCTGCCATGTGGGG + Intronic
1007003254 6:38335084-38335106 CTCTCTCCTGCTGCCATGTAAGG + Intronic
1007183473 6:39947780-39947802 CAGTCTCCAGCTGCACTGTGAGG - Intergenic
1007227848 6:40327445-40327467 CTGTTTCCTCATGCCATGTGAGG - Intergenic
1007238580 6:40408970-40408992 CCTTCCACTGCTGCCATGTGAGG - Intronic
1007295914 6:40820389-40820411 CTTGCCCCTTCTGCCATGTGAGG + Intergenic
1007863047 6:44934669-44934691 CTCACCCCTTCTGCCATGTGAGG + Intronic
1007928353 6:45668313-45668335 CTTTCACCTTCTGCCATGTGAGG - Intergenic
1008252565 6:49258373-49258395 TTCACTCCTGCTACCATGTGAGG - Intergenic
1008279520 6:49579242-49579264 CTCTCTCCTGCTGTCTTGTGAGG + Intergenic
1008560451 6:52719817-52719839 CTGGCCCCTTCTACCATGTGAGG + Intergenic
1009021024 6:57948349-57948371 CTCTTGCCTGCTGCCATGTAAGG + Intergenic
1009628259 6:66163940-66163962 TTGTCTCATTCTGCCCTGTGGGG - Intergenic
1009884591 6:69610707-69610729 CTCTCTCCTGCTACCTTGCGAGG + Intergenic
1010216499 6:73407258-73407280 CAGGCGCCTGCTGCCATGTCTGG + Intronic
1010549661 6:77205834-77205856 CTGTCTCTCTCTGCCATGTGAGG - Intergenic
1010652972 6:78477736-78477758 GTGTTTCCTTCTGCCATGTGAGG - Intergenic
1010887626 6:81263590-81263612 CTGTCTCCTGCCGCCATTTATGG + Intergenic
1011123959 6:83986498-83986520 CTCTCTCCTGCCACCCTGTGAGG - Intergenic
1011416916 6:87131547-87131569 CTTTCTCTCCCTGCCATGTGAGG - Intergenic
1011487703 6:87860143-87860165 CTCTGTCTTTCTGCCATGTGAGG - Intergenic
1011810921 6:91131238-91131260 CTCTCTCTTTCTGCCATGTAAGG + Intergenic
1012065752 6:94549417-94549439 ATTTATCCTTCTGCCATGTGAGG + Intergenic
1012147521 6:95704086-95704108 CTCTCTCCTGCTGCCATGTAGGG - Intergenic
1012226179 6:96705510-96705532 TTCTCTCCTGCTGCTATGTAAGG + Intergenic
1012625779 6:101402093-101402115 CTGTCACCTCCTGCGAGGTGAGG + Intronic
1012631979 6:101481946-101481968 CTCCTTCCTGCTGCCCTGTGAGG + Intronic
1012664125 6:101944131-101944153 CTCTCTCCTGCTACCATGTAAGG + Intronic
1012956801 6:105579797-105579819 TTCTCTCCTGCTGCCACGTGAGG - Intergenic
1013075014 6:106763562-106763584 CTGTCTACTACTGATATGTGAGG + Intergenic
1013630014 6:111977248-111977270 CTTCCTCCTTCTACCATGTGAGG + Intergenic
1013688306 6:112610753-112610775 CTTCCACCTTCTGCCATGTGAGG - Intergenic
1013693029 6:112667815-112667837 CTGTCTCCTGCTGCCATTCATGG - Intergenic
1014279462 6:119424820-119424842 CTCTCTCTCTCTGCCATGTGAGG - Intergenic
1014767562 6:125424210-125424232 GTTACTTCTGCTGCCATGTGTGG - Intergenic
1014776095 6:125511510-125511532 CTCTCTCCTGCAGCCTTGTGAGG + Intergenic
1014989216 6:128053270-128053292 CTGTCACCTCCTTCCCTGTGCGG + Intronic
1015058723 6:128936063-128936085 CTTCTTCCTGCTGCCTTGTGAGG + Intronic
1015210111 6:130687248-130687270 CTGGTGCCTTCTGCCATGTGAGG - Intergenic
1015239466 6:131007293-131007315 CTCTCTCCTGCCGCCCTGTGAGG + Intronic
1015542260 6:134326826-134326848 CTCTCTCTCCCTGCCATGTGAGG - Intergenic
1015560595 6:134511122-134511144 CTCTCTCTTGCGGTCATGTGAGG - Intergenic
1015684676 6:135846684-135846706 CTCTCTCCTTCCACCATGTGAGG - Intergenic
1015977027 6:138800968-138800990 CTTCCACCTTCTGCCATGTGAGG - Intronic
1016040973 6:139431694-139431716 CTTACCCCTTCTGCCATGTGAGG + Intergenic
1016083692 6:139886114-139886136 CTATCTCTTTCTGCCATGTGAGG - Intergenic
1016137015 6:140556052-140556074 TTGGCTTCTTCTGCCATGTGAGG - Intergenic
1016264186 6:142212748-142212770 CTGTCTCCTGCTGCCATGTGAGG - Intronic
1016388042 6:143548178-143548200 CTTCCTCCCTCTGCCATGTGAGG - Intronic
1016505952 6:144779140-144779162 TTGTCACCTGATGCCATGTGGGG + Intronic
1016904638 6:149136764-149136786 CCTTCCCCTTCTGCCATGTGAGG - Intergenic
1016912941 6:149216714-149216736 CTGTCTCCTTCTGCCTTCTCCGG + Intergenic
1017018912 6:150124419-150124441 CTCTCTCCTGCTGCCATGTAAGG - Intergenic
1017087283 6:150725183-150725205 TTTGCTCCTTCTGCCATGTGAGG - Intronic
1017131774 6:151114108-151114130 CTGTTTCCTGCTGCCATCTTGGG - Intergenic
1017334579 6:153240276-153240298 CTCTTGCCTGCTGCCATGTAAGG + Intergenic
1017684199 6:156895540-156895562 GTGTCCCCTCCTGCCTTGTGTGG + Intronic
1018065003 6:160118657-160118679 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1018098453 6:160414650-160414672 CTCCTGCCTGCTGCCATGTGAGG - Intronic
1018445412 6:163853674-163853696 CTCTCTCTTCCTGCCATGTGAGG + Intergenic
1018705883 6:166462715-166462737 CTTCCTCCTGCTGCCGTGTGAGG - Intronic
1018783487 6:167090202-167090224 CTGACTCTTGCTTCCATTTGAGG - Intergenic
1018826200 6:167409505-167409527 CTGTTCCCTCCTGCCATCTGGGG - Intergenic
1018972318 6:168538064-168538086 CTGACCCCTGCTGGGATGTGGGG + Intronic
1019296136 7:276405-276427 CTGCCTCCTGCTGCCATTCGTGG + Intergenic
1019503819 7:1380517-1380539 CTGCCTCCTGCTGCTTTCTGGGG - Intergenic
1019620373 7:1988846-1988868 CTGCCTCCTGCAGCCTGGTGCGG - Intronic
1019864924 7:3698734-3698756 CTCTCTCTACCTGCCATGTGAGG - Intronic
1019897964 7:3997841-3997863 CTGCCTCCTGCTGCCATTCATGG + Intronic
1019914142 7:4121468-4121490 TTCTCTCCTGCTGGCATGTGAGG + Intronic
1020407809 7:7856359-7856381 CTCTCTCTTGCTGCCTTGTGAGG - Intronic
1020458069 7:8396777-8396799 CTCTCTCTATCTGCCATGTGAGG - Intergenic
1020837926 7:13177680-13177702 CTCTCTCCTGCCACCATGTGAGG - Intergenic
1020910109 7:14118431-14118453 CACTCTCCTGTTGCCATGTGAGG + Intergenic
1021325293 7:19258821-19258843 CTCTCTCCTGCTGCCCTGTGAGG + Intergenic
1021346284 7:19532597-19532619 CTGTCTCATGATGCCTTGTGAGG + Intergenic
1021367735 7:19801661-19801683 CTTGCCCCTTCTGCCATGTGAGG + Intergenic
1021435664 7:20612330-20612352 CTCTCTCCTGCCACCCTGTGAGG - Intergenic
1021534292 7:21685603-21685625 GTGTCTCCTTCTTCCATATGTGG + Intronic
1021792001 7:24215387-24215409 ATGTCTCCTGCTGGGATGTTAGG - Intergenic
1021973796 7:25991368-25991390 CTCTCTCCTGCCACCATGTAAGG + Intergenic
1022150296 7:27596228-27596250 ATGCCCCCTTCTGCCATGTGAGG - Intronic
1022748039 7:33192807-33192829 CTCTGTTCTTCTGCCATGTGAGG - Intronic
1023134630 7:37038842-37038864 CTCTCTCTTTCTACCATGTGAGG - Intronic
1023789085 7:43737658-43737680 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1023790480 7:43749800-43749822 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1023820652 7:43978755-43978777 CTGCCTCCTGATCCCATCTGGGG - Intergenic
1023988876 7:45115991-45116013 CTTTCTCCTTCTGCCATGTGAGG + Intergenic
1024123378 7:46267432-46267454 CTCTCTCTTTCTGCCATGTGAGG + Intergenic
1024280460 7:47714807-47714829 CTGTGTGCAGCTGCCTTGTGTGG - Intronic
1024490691 7:49980555-49980577 CTTTCACCTTCTGCCATGGGTGG - Intronic
1024840688 7:53583770-53583792 CTGTCTGTTTCTGCAATGTGGGG + Intergenic
1024964648 7:55013194-55013216 CTTGGTCCTTCTGCCATGTGAGG + Intergenic
1024990779 7:55233332-55233354 CGGTCTCCAGGTGCCATGGGTGG - Intronic
1025143289 7:56483482-56483504 CTGTCTCCTGCTGCTCCGTGAGG + Intergenic
1025285529 7:57657542-57657564 CTTCCACCTTCTGCCATGTGAGG - Intergenic
1026122297 7:67548516-67548538 CTCTTGCCTGCTGCCATGTATGG + Intergenic
1026359650 7:69591630-69591652 CTGCCTCCTGCTGCCATTCCTGG + Intergenic
1026854567 7:73744487-73744509 CTGTATCCTGCAGGCAAGTGGGG - Intergenic
1027128324 7:75572998-75573020 CTGCCTCCCGCTGCCATGCATGG - Intronic
1027566154 7:79797442-79797464 CTCTCTCCTGCTGCCATGTGAGG - Intergenic
1027662091 7:80999227-80999249 CTGTCTCCTCGTGCAATGTCTGG + Intergenic
1028045371 7:86110768-86110790 CTTTCTCCTGCTGCCAACTTTGG + Intergenic
1028052286 7:86202953-86202975 CTGCCTCCTGCTGCCATTCCTGG + Intergenic
1028498683 7:91492396-91492418 CTTGCTCCTTCTACCATGTGAGG + Intergenic
1028815490 7:95139229-95139251 CTCTCTCCTGCTGCCCTGTGAGG - Intronic
1029375357 7:100174113-100174135 ATCTCACCTGCTGCCACGTGGGG - Intronic
1029678072 7:102085529-102085551 CTCCTTCCTGCTGCCATGTGAGG + Intronic
1029748931 7:102532198-102532220 CTGCCTCCTGATCCCATCTGGGG - Intergenic
1029766874 7:102631304-102631326 CTGCCTCCTGATCCCATCTGGGG - Intronic
1029804428 7:102981698-102981720 CTTGGTCCTACTGCCATGTGTGG - Intronic
1029899276 7:104022373-104022395 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1030124419 7:106141019-106141041 CTGGCCCCTTCTGCCATGTGAGG - Intergenic
1030318346 7:108139190-108139212 CTCTCTCTCTCTGCCATGTGAGG - Intergenic
1030514088 7:110519510-110519532 CTGCCTTCTGCTGCCATTTATGG + Intergenic
1030754545 7:113272222-113272244 CTCTCTCCTGCTGCCAGGTAAGG - Intergenic
1030874801 7:114800550-114800572 CTTGCTCCTTCTGCCATGTGAGG - Intergenic
1031161915 7:118179051-118179073 TTGCCCCCTTCTGCCATGTGAGG + Intergenic
1031203448 7:118721869-118721891 TTTACTCCTTCTGCCATGTGAGG - Intergenic
1031285647 7:119863888-119863910 CTTGCCCCTTCTGCCATGTGAGG + Intergenic
1031435479 7:121727765-121727787 CTCTCTTCTGCTGCCTTGTGAGG - Intergenic
1032121763 7:129162068-129162090 CTGTTTCCTGGTGACTTGTGTGG - Intronic
1032301226 7:130689193-130689215 TTTACTCCTTCTGCCATGTGAGG + Intergenic
1032792406 7:135252259-135252281 CTCTCTCCTGTCACCATGTGAGG - Intronic
1033270832 7:139931546-139931568 CTTTCACCTTCTGCCATGTTTGG - Intronic
1033270835 7:139931574-139931596 CTCTTGTCTGCTGCCATGTGAGG - Intronic
1033310995 7:140261721-140261743 CTCTCTCTCTCTGCCATGTGGGG + Intergenic
1033357341 7:140610885-140610907 CTTTCTTCTGCTGCCATTTTTGG + Intronic
1033551522 7:142451971-142451993 CTCTCTACTGCAGCCATGAGGGG + Intergenic
1033553784 7:142470513-142470535 CTCTCTACTGCAGCCATGGGGGG + Intergenic
1033558363 7:142508290-142508312 CTCTCTACTGCAGCCATGAGGGG + Intergenic
1033985053 7:147214935-147214957 CTGTCTCCTGCTGCCTTGTGAGG - Intronic
1034072299 7:148198191-148198213 CTGTGATCTGCTGCCATGGGGGG - Intronic
1034157695 7:148968968-148968990 CTTTCACCTGCTGCCATGATTGG + Intergenic
1034474264 7:151273773-151273795 GTGCCTGCTGCTGCCCTGTGTGG + Intronic
1034487039 7:151372593-151372615 AAGACTCCTGCTGGCATGTGTGG + Intronic
1035252425 7:157605971-157605993 CTGTCTCCTGCTGCCATTCATGG + Intronic
1035337443 7:158138894-158138916 GTTTCTCCTTCTGCCAAGTGAGG - Intronic
1035357121 7:158282864-158282886 CTGTGTCCCGCTGCTGTGTGTGG - Intronic
1035619033 8:1024028-1024050 CTCTGTCCAGGTGCCATGTGCGG + Intergenic
1035897733 8:3422903-3422925 CCTTTTCCTTCTGCCATGTGAGG - Intronic
1035981601 8:4378810-4378832 TTTTCCCCTTCTGCCATGTGAGG + Intronic
1036077285 8:5515775-5515797 CTCTCTCTTTCTGCCATGTGAGG - Intergenic
1036079886 8:5543432-5543454 ATGTGATCTGCTGCCATGTGAGG + Intergenic
1036180664 8:6581878-6581900 CTCACCCCTTCTGCCATGTGAGG - Intronic
1036447128 8:8831118-8831140 GTGTCTCTCTCTGCCATGTGAGG - Intronic
1036592431 8:10181121-10181143 CTGTCCCCTCCTCCCATCTGCGG - Intronic
1036681568 8:10878178-10878200 CTGTCTCCTACTCCCATCAGGGG + Intergenic
1037470255 8:19201626-19201648 CTCTCGCCTTCTGCCATGAGTGG + Intergenic
1038074850 8:24060553-24060575 CTTCCTCCTTCTGCCATGTGAGG - Intergenic
1038680435 8:29662508-29662530 CTCACTCCTTCTACCATGTGAGG - Intergenic
1038817474 8:30919872-30919894 CTGTCTTTCTCTGCCATGTGAGG + Intergenic
1038843495 8:31207448-31207470 CTTTCTCTTGTTGCCTTGTGAGG + Intergenic
1038895517 8:31777704-31777726 CTTTTTCCTTCTGCCATGGGTGG - Intronic
1038926874 8:32150503-32150525 CCTTCTGCTTCTGCCATGTGAGG + Intronic
1039420239 8:37431778-37431800 GTCTCTCTTGCAGCCATGTGTGG - Intergenic
1039748780 8:40457579-40457601 CTGGCTCCTGCTGCCAGGGTTGG - Intergenic
1039758726 8:40550685-40550707 CTCCATCCTGCTGCCCTGTGAGG + Intronic
1039830148 8:41206958-41206980 CTGTCTCATCCTGCCGTGTTTGG - Intergenic
1040599833 8:48872308-48872330 CTGTCTCCTCCTGTCGGGTGGGG - Intergenic
1040797997 8:51308217-51308239 CTTGCTCTTCCTGCCATGTGTGG - Intergenic
1040860240 8:51991264-51991286 CCTTCTCCTTCTGCCATGGGTGG + Intergenic
1040947324 8:52897266-52897288 CTGCCTCTTTCTGCCATGAGTGG - Intergenic
1041422892 8:57689352-57689374 CTTGCTCCTTCTGCCATGTGAGG - Intergenic
1041756612 8:61320683-61320705 TTTTCTCCTACTACCATGTGAGG - Intronic
1042011163 8:64246222-64246244 CTCTCTCCTGCTGCCCTGTAAGG - Intergenic
1042169552 8:65978335-65978357 CTTACACCTTCTGCCATGTGAGG + Intergenic
1042337078 8:67640250-67640272 CTGCCTCCTGCTGCCATTCATGG + Intronic
1042376383 8:68057206-68057228 CTCTCACCTGCTGCCGTGTAAGG + Intronic
1042579906 8:70265245-70265267 CTTTCTCTCCCTGCCATGTGAGG + Intronic
1042662739 8:71173792-71173814 CTGTGTCCTGCAGCCATCTAAGG - Intergenic
1042714585 8:71758874-71758896 CTCTTACCTGCTGCCATGTAAGG - Intergenic
1043214704 8:77570853-77570875 CTCTCTCCTGATGCCACGTAAGG - Intergenic
1044139671 8:88635001-88635023 CAGGCTCCTGCTGCCATGCCTGG - Intergenic
1045683145 8:104683856-104683878 TTTTGTCCTTCTGCCATGTGAGG - Intronic
1045700884 8:104864776-104864798 CTCTCTCCTGCCACCATGTAAGG - Intronic
1046915291 8:119672767-119672789 CTGTCTCCTGGAGGCAAGTGTGG + Intronic
1047252867 8:123193778-123193800 CTCACTCCTTCTGCCATGTGAGG - Intronic
1047636925 8:126773935-126773957 TTGTGCCCTTCTGCCATGTGAGG - Intergenic
1047795289 8:128248954-128248976 CTGTTTCCTTGTGCAATGTGAGG - Intergenic
1048499850 8:134965521-134965543 CTCCTTGCTGCTGCCATGTGAGG + Intergenic
1048763696 8:137824613-137824635 ATTTCTCTTTCTGCCATGTGAGG + Intergenic
1048895382 8:138987914-138987936 CTCCCTCCTTCTGCCATGTGAGG - Intergenic
1049043075 8:140127011-140127033 CTTTCTCCAGCAGCCATGTCTGG + Intronic
1049113094 8:140661867-140661889 CTGAGTGCAGCTGCCATGTGAGG + Intronic
1049617889 8:143583870-143583892 CTCGCTCCTGCTGCCTAGTGTGG - Intronic
1050483954 9:6114564-6114586 CTGGCTCCTGCTGCCATTCATGG - Intergenic
1050585778 9:7109967-7109989 CTCTCTCCTGCTGTCCTGTGAGG + Intergenic
1050959024 9:11703692-11703714 CTCTCACCTGCTGCCATGTAAGG + Intergenic
1051616174 9:19009083-19009105 CTGTCTGCTGTTGCTGTGTGGGG - Intronic
1051637485 9:19194222-19194244 CTCTCTCCTGCCGTCTTGTGAGG - Intergenic
1051708258 9:19903303-19903325 CTGTTTCTCTCTGCCATGTGAGG - Intergenic
1051867760 9:21700323-21700345 CTCTCTCTTTCTACCATGTGGGG - Intergenic
1051921437 9:22271096-22271118 CTTGCTCCTTCTACCATGTGAGG - Intergenic
1051940586 9:22501144-22501166 CTCTCTCCTGCCACCTTGTGAGG - Intergenic
1052125418 9:24768739-24768761 CTTTCTCCTTCTGTCATGAGTGG - Intergenic
1052184267 9:25571905-25571927 CTGTCTCCTTGTTCCATGTGAGG - Intergenic
1052211128 9:25904847-25904869 CTTTCTCTTTCTGTCATGTGAGG - Intergenic
1052654273 9:31335203-31335225 TTGTCTCCTGCTGCCATTCGTGG + Intergenic
1053128148 9:35599419-35599441 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1053208731 9:36209699-36209721 CTGCCACCTGCTCCCAGGTGGGG - Intronic
1053449831 9:38184159-38184181 CCTTCTCCTTCTGCCATGAGGGG - Intergenic
1053534681 9:38913777-38913799 CTTTCACCTTCTGCCATGTGTGG + Intergenic
1053576063 9:39358061-39358083 CTGTCTCCTGCAGCCTCCTGGGG + Exonic
1053793211 9:41701450-41701472 CTTCCGCCTTCTGCCATGTGAGG - Intergenic
1053840579 9:42185998-42186020 CTGTCTCCTGCAGCCTCCTGGGG + Exonic
1054097635 9:60916752-60916774 CTGTCTCCTGCAGCCTCCTGGGG + Intergenic
1054119037 9:61192382-61192404 CTGTCTCCTGCAGCCTCCTGGGG + Exonic
1054151966 9:61613389-61613411 CTTCCGCCTTCTGCCATGTGAGG + Intergenic
1054181620 9:61913462-61913484 CTTCCGCCTTCTGCCATGTGAGG - Intergenic
1054206900 9:62138197-62138219 CTTTCACCTTCTGCCATGTGTGG + Intergenic
1054471738 9:65544519-65544541 CTTCCGCCTTCTGCCATGTGAGG + Intergenic
1054588715 9:66990180-66990202 CTGTCTCCTGCAGCCTCCTGGGG - Intergenic
1054631450 9:67450150-67450172 CTTTCACCTTCTGCCATGTGTGG - Intergenic
1055689777 9:78816932-78816954 CTCTGTCCTCTTGCCATGTGAGG - Intergenic
1055787347 9:79884770-79884792 CTGTCTCCTGCAGCCATCTGGGG - Intergenic
1055862333 9:80767629-80767651 CTCTCTCCTCCTGCCACGTGAGG - Intergenic
1055880123 9:80990880-80990902 CTCTCTCTTTCTGCCATTTGAGG - Intergenic
1055880175 9:80991510-80991532 CTCTCTCTTTCTGCCATTTGAGG - Intergenic
1055926900 9:81519660-81519682 CTCTCTCCAGCTGCCTTGTAAGG - Intergenic
1056192069 9:84194556-84194578 CTGCCTCCTGCTGCCATTCAAGG + Intergenic
1056580293 9:87884900-87884922 TTGTCTCCTGCAGCCACCTGAGG + Exonic
1056584664 9:87920239-87920261 CTGTCTCCTGCAGCCTCCTGGGG + Intergenic
1056612210 9:88132701-88132723 CTGTCTCCTGCAGCCTCCTGGGG - Intergenic
1056849853 9:90073294-90073316 CTGTCTCCTGCAGGCTAGTGAGG + Intergenic
1057035107 9:91806323-91806345 CTTTCTCCTTCTGCCATGTGAGG - Intronic
1057177343 9:93009935-93009957 CTGTCTCCTCCTGTCAAGAGTGG - Intronic
1057548495 9:96035188-96035210 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1058140667 9:101354299-101354321 TTTGCTCCTTCTGCCATGTGAGG - Intergenic
1058293898 9:103280499-103280521 CTTCCACCTTCTGCCATGTGAGG + Intergenic
1058487631 9:105458138-105458160 TTGTCACTTGCTGTCATGTGGGG + Intronic
1058541264 9:106014880-106014902 GTTTCTCCTTCTACCATGTGAGG - Intergenic
1058987841 9:110225160-110225182 CTCCCTCCTGCTGCCTTGTGAGG + Intergenic
1059009274 9:110439247-110439269 CTCTCTCTCCCTGCCATGTGAGG + Intronic
1059565469 9:115379806-115379828 CTGCCTCCTGCTGCCATTCATGG - Intronic
1059682444 9:116599177-116599199 CTGCCTACTGCTGTCACGTGAGG + Intronic
1059908939 9:119021147-119021169 CTGTCCCCATCTGCCATATGGGG + Intergenic
1059959688 9:119552940-119552962 CTCTCTCCTGCCACCGTGTGTGG - Intergenic
1060180136 9:121527972-121527994 CTGCCTCCTGCTGCCATTCATGG + Intergenic
1060659958 9:125399512-125399534 CTGTCTCCTGCTTCCGTGTGTGG - Intergenic
1060789663 9:126477556-126477578 CTCTTGCCTGCTGCCATGTAAGG - Intronic
1060804269 9:126564757-126564779 CTATCTGCTGCTGAAATGTGGGG - Intergenic
1061267328 9:129514397-129514419 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1061388638 9:130304986-130305008 CTGGCTCCTGGTGCGAGGTGAGG + Intronic
1061401070 9:130368722-130368744 CTCTCTCCTGCCGACATGTAAGG - Intronic
1061595933 9:131629053-131629075 CTTTCTCATTCTGCCATGGGAGG + Intronic
1061618290 9:131794257-131794279 CAGGGTCCTGATGCCATGTGGGG + Intergenic
1061780176 9:132991235-132991257 ATTTCTCCTGCTGCCAAGTGTGG + Exonic
1061858520 9:133456047-133456069 CTGTCTCCTGCTCCCTTTTCAGG + Exonic
1062523696 9:136969907-136969929 CTGCCCCCTGCAGCCCTGTGTGG + Exonic
1062531329 9:137001951-137001973 CTCGCTCCTCCTGCCAGGTGAGG + Intergenic
1203670689 Un_KI270755v1:8579-8601 GAGTCTACTGCTGCCATATGAGG - Intergenic
1185820128 X:3194910-3194932 CTCTCTCCTGCTGCCTTGTGAGG + Intergenic
1185913977 X:4014374-4014396 CCCTCCCCTTCTGCCATGTGTGG + Intergenic
1185952333 X:4450911-4450933 CTCTTGCCTGCTGCCATGTGAGG + Intergenic
1186033384 X:5393768-5393790 CTCTCTCTGGCTGCCAAGTGAGG + Intergenic
1186645031 X:11497579-11497601 CTCTCTCTCTCTGCCATGTGAGG + Intronic
1186690885 X:11974387-11974409 CTTTCACCTTCTGCCATGAGTGG + Intergenic
1187108279 X:16268077-16268099 CTCTCTCCTGCTGCAATTTGTGG - Intergenic
1187115662 X:16347633-16347655 CTCTCTCTCACTGCCATGTGAGG + Intergenic
1187440509 X:19313764-19313786 TTTTCACCTTCTGCCATGTGAGG - Intergenic
1187598284 X:20799075-20799097 CTCTCTCCTGCTGCCTTGTGAGG + Intergenic
1187725922 X:22201874-22201896 CTGTCTCCTGTTCCCATGGCTGG - Intronic
1188293514 X:28417570-28417592 CTCGCCCCTTCTGCCATGTGAGG - Intergenic
1188374667 X:29413159-29413181 CTCTTGCCTGCTGCCATGTAAGG + Intronic
1188827685 X:34856366-34856388 CTTTCACCTTCTGCCATGTGAGG - Intergenic
1189071148 X:37865711-37865733 CTCTCTCCTGCTGCCCTGTGAGG - Intronic
1189178468 X:38981216-38981238 CTTGCTCCTTCTGACATGTGTGG + Intergenic
1189229625 X:39442204-39442226 CTCTCTCTTTCTGTCATGTGAGG - Intergenic
1189360160 X:40343858-40343880 CTGCCTCCTGCTGCCATTCATGG - Intergenic
1189375219 X:40461270-40461292 CTCCCTCTTTCTGCCATGTGAGG - Intergenic
1189381730 X:40506985-40507007 GTGTCTCTGGCTGCCTTGTGTGG - Intergenic
1189569758 X:42283934-42283956 CTTGCTCCTTCTGCCATGTGAGG + Intergenic
1189621151 X:42839754-42839776 CCTTCTCCTTCTGCCATGAGTGG - Intergenic
1189728881 X:43997817-43997839 CTCTCTCCTACCGCCTTGTGAGG - Intergenic
1190302000 X:49062458-49062480 CTGTGTCCAGCTGCCCTGTTCGG + Exonic
1190506751 X:51134165-51134187 TGGTCACCTGCTGCCCTGTGGGG - Intergenic
1190528067 X:51347887-51347909 CTGTCTCCTGCCACCATGTGAGG - Intergenic
1190656933 X:52620923-52620945 CTGTCTCCTGCTACCATGTGAGG - Intergenic
1191727314 X:64294729-64294751 TTTTCTCCTTCTGTCATGTGAGG - Intronic
1192698748 X:73446300-73446322 GTGTCTCCTTCTGCCAGGTATGG - Intergenic
1192816558 X:74599604-74599626 CTTTGTCCTTTTGCCATGTGAGG + Intronic
1193398316 X:81012318-81012340 CTCTCTCCTGACACCATGTGAGG + Intergenic
1193448794 X:81640986-81641008 CTTTCTCTTGCTGCTTTGTGAGG - Intergenic
1193558249 X:82983711-82983733 CTGTCTCTTTCTGTCATGTTGGG + Intergenic
1193971928 X:88066078-88066100 CTCTCTACTGCCACCATGTGAGG + Intergenic
1194036899 X:88886094-88886116 CTCTCTCCTGCCACCATGTAAGG + Intergenic
1194134880 X:90129454-90129476 CTCTCTCCTGCTGCCATGTAAGG + Intergenic
1194562982 X:95446448-95446470 CTTTCTTCTGCTACCATGTAAGG - Intergenic
1194568258 X:95520860-95520882 CTCTCTCCTGCCTCCCTGTGAGG - Intergenic
1194601120 X:95923064-95923086 TTGTCCCTTACTGCCATGTGAGG - Intergenic
1194659861 X:96618782-96618804 CTCCTTGCTGCTGCCATGTGAGG - Intergenic
1194818003 X:98469028-98469050 TTGTGTCCTTCTGCCATGTGAGG - Intergenic
1195050665 X:101093879-101093901 CTTGCCCCTTCTGCCATGTGAGG - Intronic
1195430321 X:104781979-104782001 CTTGCCCCTTCTGCCATGTGAGG + Intronic
1195454304 X:105051170-105051192 CTGCCTCCTGCTGCCATTTATGG + Intronic
1195454754 X:105055220-105055242 CTTGCTCTTTCTGCCATGTGAGG - Intronic
1195627378 X:107018386-107018408 CTTTGTCCTTCTACCATGTGAGG - Intergenic
1195690520 X:107620654-107620676 CTGTCACCTTCTGCCATGATTGG - Intergenic
1195758190 X:108219998-108220020 CTATTACCTGCTGCCATCTGGGG + Intronic
1195980071 X:110568160-110568182 CATTCTCCTGCTTCCAGGTGGGG - Intergenic
1196517051 X:116626460-116626482 CTCACTCCTTCTGCCTTGTGAGG + Intergenic
1196558834 X:117122535-117122557 CTCTCTCCTGCAGCCAAGGGAGG + Intergenic
1196835404 X:119809138-119809160 CTCTCGCCTGCTGTCATGTAAGG - Intergenic
1197482127 X:127000289-127000311 CTTTTACCTTCTGCCATGTGCGG - Intergenic
1197566644 X:128096032-128096054 CTCTTGTCTGCTGCCATGTGAGG - Intergenic
1197762743 X:130039179-130039201 CTGGCTCCTGCTGTCCTATGGGG + Exonic
1198455354 X:136812214-136812236 CTGGCTCCTTCCACCATGTGAGG - Intergenic
1198597225 X:138249782-138249804 CGCTCTCTTTCTGCCATGTGAGG + Intergenic
1198775426 X:140173707-140173729 CTCTCTCCTGCTGCCCTATGTGG + Intergenic
1198802484 X:140461702-140461724 CTTGCTCCTATTGCCATGTGAGG + Intergenic
1198804118 X:140476324-140476346 CTCTTTCCTGCCACCATGTGAGG + Intergenic
1199083578 X:143604901-143604923 CTCTCGACTGCTGCCATGTAAGG + Intergenic
1199214360 X:145248834-145248856 CTGTATCCTTCTGCCCTGTAAGG - Intronic
1199272807 X:145904823-145904845 CTCTCTCCTGCCACCTTGTGAGG + Intergenic
1199309709 X:146308406-146308428 CTCTCTCCTGCTTCCCTGTGAGG + Intergenic
1199348718 X:146774433-146774455 CTCTCTTCTGCTGCCTTTTGAGG - Intergenic
1199695074 X:150338202-150338224 CTGTCTCCTTCTGCCGTGTGAGG - Intergenic
1199736063 X:150687760-150687782 CTTTTACCTTCTGCCATGTGAGG + Intergenic
1199762473 X:150915714-150915736 CTCTCTCTTGCTGACATGTGAGG + Intergenic
1199802359 X:151264240-151264262 CTCTCCCGTTCTGCCATGTGAGG + Intergenic
1199948882 X:152689645-152689667 CTTTCTCTCTCTGCCATGTGAGG + Intergenic
1199960794 X:152778804-152778826 CTTTCTCTCTCTGCCATGTGAGG - Intergenic
1200357100 X:155563291-155563313 CTGTCTCCTGCTACCATGTAAGG - Intronic
1200384956 X:155881265-155881287 GTGTCGCCTGCTGCCATTGGAGG + Intergenic
1200480666 Y:3699545-3699567 CTCTCTCCTGCTGCCATGTAAGG + Intergenic
1200641059 Y:5718550-5718572 CTCTTGCCTGCTGCCATGTAAGG + Intronic
1200944118 Y:8815273-8815295 CTTTCCCCTTCTACCATGTGAGG - Intergenic
1201446687 Y:14064601-14064623 CTTTCCCCTTCTACCATGTGAGG + Intergenic
1201550808 Y:15214565-15214587 CTGTTTCCTGCTTCCAGGTTGGG + Intergenic
1201676099 Y:16586104-16586126 CTCGCCCCTTCTGCCATGTGAGG + Intergenic
1201688196 Y:16731439-16731461 CTGGCCCCTTCTACCATGTGAGG - Intergenic
1201744379 Y:17354441-17354463 TTGTCTACTGCTTCCATGTAAGG - Intergenic