ID: 1016264192

View in Genome Browser
Species Human (GRCh38)
Location 6:142212761-142212783
Sequence CAGGAGACAGAGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4939
Summary {0: 1, 1: 15, 2: 120, 3: 806, 4: 3997}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016264186_1016264192 -10 Left 1016264186 6:142212748-142212770 CCTCACATGGCAGCAGGAGACAG 0: 2
1: 10
2: 51
3: 200
4: 987
Right 1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG 0: 1
1: 15
2: 120
3: 806
4: 3997

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016264192 Original CRISPR CAGGAGACAGAGAGGGAAGG GGG Intronic
Too many off-targets to display for this crispr