ID: 1016270722

View in Genome Browser
Species Human (GRCh38)
Location 6:142286880-142286902
Sequence TTATGCAGCCTGGCAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016270722_1016270728 25 Left 1016270722 6:142286880-142286902 CCTATTTTTGCCAGGCTGCATAA No data
Right 1016270728 6:142286928-142286950 CTTTACTGCTAAAGCTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016270722 Original CRISPR TTATGCAGCCTGGCAAAAAT AGG (reversed) Intergenic
No off target data available for this crispr