ID: 1016272249

View in Genome Browser
Species Human (GRCh38)
Location 6:142302207-142302229
Sequence GTCCCGCCGCGGCGCAGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016272245_1016272249 -2 Left 1016272245 6:142302186-142302208 CCAGAAACGGCGTAAAGGAGGGT 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1016272238_1016272249 22 Left 1016272238 6:142302162-142302184 CCGTCGGGAAAGCCCATGAACTC 0: 1
1: 0
2: 1
3: 1
4: 76
Right 1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1016272237_1016272249 29 Left 1016272237 6:142302155-142302177 CCTTGCGCCGTCGGGAAAGCCCA 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1016272241_1016272249 9 Left 1016272241 6:142302175-142302197 CCATGAACTCTCCAGAAACGGCG 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1016272240_1016272249 10 Left 1016272240 6:142302174-142302196 CCCATGAACTCTCCAGAAACGGC 0: 1
1: 0
2: 0
3: 30
4: 152
Right 1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016272249 Original CRISPR GTCCCGCCGCGGCGCAGGGC TGG Exonic
901540070 1:9910034-9910056 GCCCCGGCGCGGCGCGGCGCGGG + Intronic
903614674 1:24643260-24643282 GCGCCGCCGCGACGGAGGGCGGG - Exonic
903639407 1:24848330-24848352 CTCCCCCGGCGGGGCAGGGCAGG + Intergenic
903925104 1:26826557-26826579 GCCCCGCCGCGGGTCAGAGCTGG + Intergenic
904336247 1:29800288-29800310 GTCCCGCCTTGGCCCAGGGTGGG + Intergenic
905548392 1:38817761-38817783 GTGCCGCCGCGGGGATGGGCGGG + Intergenic
905761126 1:40559013-40559035 GCCTCCCCGCGGGGCAGGGCTGG - Intergenic
907254117 1:53165266-53165288 TTCCCGCTGTGGAGCAGGGCAGG + Intergenic
908523517 1:64966567-64966589 GGCCGGCCGCGGGGCGGGGCGGG - Intergenic
910759101 1:90718004-90718026 GGCCCGGCGCGGCGCGGCGCGGG - Intergenic
911078990 1:93909504-93909526 ATCCCGCGGCGGGGCAGGGGCGG + Intergenic
915544984 1:156592008-156592030 GCCCCGCCCCGGGGCAGAGCAGG - Intronic
915616953 1:157046118-157046140 GCCGCGCCGAGGGGCAGGGCCGG - Intergenic
920312497 1:205056821-205056843 GTCCTGCTGCAGGGCAGGGCAGG - Intronic
920409697 1:205749731-205749753 GCCCTGCAGCGGCGCGGGGCGGG + Intronic
921325341 1:213982820-213982842 CTCCCGGCGCGCCGCAGAGCCGG - Intergenic
922480912 1:225939727-225939749 GTCGCGCGGGCGCGCAGGGCAGG - Intronic
923506817 1:234611241-234611263 GGCCCGCCGTCCCGCAGGGCGGG + Intergenic
924436822 1:244049286-244049308 GTGCAGCTGCGGCGCGGGGCGGG + Intronic
924732489 1:246724539-246724561 GGCCCGCCACGGCCCAGGGCAGG - Exonic
1065993129 10:31031942-31031964 CTCCCGCCGCGGCGCCGGGGCGG - Intergenic
1071694997 10:87862151-87862173 TTTCCGCCGCGGCGCAGGAAGGG + Exonic
1073110690 10:101061544-101061566 GTCTCCCCGCAGCCCAGGGCTGG - Intergenic
1073297653 10:102450814-102450836 TGCCGGCGGCGGCGCAGGGCCGG + Exonic
1074503123 10:114043999-114044021 GGGCAGCCGCGGCGCGGGGCCGG - Intergenic
1074586052 10:114768362-114768384 GCTCTGCCGCGGCGCCGGGCGGG + Intergenic
1074591859 10:114821689-114821711 GCCCCGCCGCAGGGCAGGCCTGG + Intergenic
1075375482 10:121975033-121975055 GTCCCGCCGCGGCTCTGCGCGGG - Exonic
1076372266 10:129963510-129963532 CTCCCGCAGCGGCGTGGGGCTGG - Exonic
1076373822 10:129970856-129970878 GTCCCGCCGCCGCGCGCTGCTGG - Intergenic
1077046967 11:551022-551044 GACCCACCGTGGGGCAGGGCAGG - Intronic
1077962441 11:7089571-7089593 GGGCCGCCGCCGCGCAGGGTCGG + Exonic
1080012495 11:27472560-27472582 CCCCCGCCGCTGCGCCGGGCCGG - Exonic
1082816995 11:57515531-57515553 GCGCCGGCGCGGCTCAGGGCTGG - Exonic
1083721898 11:64607533-64607555 GTCACGCCGGGGCGCAGGGGAGG + Exonic
1083992095 11:66252736-66252758 GTCCCTCCACTGAGCAGGGCAGG + Intergenic
1084395019 11:68903897-68903919 GTCCCGCTTCTGCGCCGGGCCGG - Exonic
1086424763 11:86672355-86672377 GTCCCGCTGCGGAGCAGGCGGGG + Exonic
1087761803 11:102110643-102110665 GTGGAGCCGGGGCGCAGGGCGGG + Exonic
1089543577 11:119206008-119206030 GCCCCGCCCCGGCGTAGGGGCGG + Intergenic
1092184839 12:6471033-6471055 GTCCCGGCGCGGGGTGGGGCAGG - Intergenic
1096668224 12:53181023-53181045 GTCCCGCCGCGTCCCCGGCCCGG + Intronic
1096695257 12:53344797-53344819 GTCCCGGCGCGGCCGAGGGGCGG + Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103595454 12:122022281-122022303 GGCCCGCGGCGGGGCTGGGCCGG - Intronic
1105037775 12:132938981-132939003 GCCTCCCCGCGGGGCAGGGCTGG + Intronic
1105353175 13:19633974-19633996 GCCCCGGCGCGGGGCTGGGCGGG + Intronic
1105525679 13:21176239-21176261 CTGCCACCGAGGCGCAGGGCGGG - Intronic
1106269489 13:28139110-28139132 GGGCCGCGGCGGCGGAGGGCAGG + Intronic
1113494137 13:110714340-110714362 GGCGCGCCGCGGAGCCGGGCCGG + Intronic
1114554150 14:23551816-23551838 CGCCCGCCGCGGCGCATGCCGGG + Intronic
1118220682 14:63852839-63852861 GCCCCGCCGCAGCCCGGGGCGGG - Intergenic
1121927071 14:97937420-97937442 GTCCAGCAGCCGAGCAGGGCTGG + Intronic
1122293488 14:100692332-100692354 GTCCCTGCCCGGCGCCGGGCTGG + Intergenic
1122494009 14:102139485-102139507 GTCCCGGCGCCCCTCAGGGCAGG + Exonic
1122582021 14:102777234-102777256 GCGGCGCCGCGGCGCGGGGCGGG - Intergenic
1122582209 14:102777794-102777816 GGCCCGGCGCGGCGCAGGCCCGG + Intronic
1122736799 14:103847891-103847913 GTCCCGCAGCGGATCACGGCAGG + Intergenic
1123059186 14:105586776-105586798 GGCCCCCCGAGGCTCAGGGCAGG + Intergenic
1124629559 15:31328586-31328608 GCCCCGCACCGGCCCAGGGCAGG - Intronic
1125584017 15:40807662-40807684 GTCCCGCCGCGACCTAGAGCAGG - Exonic
1125605581 15:40938057-40938079 GTCCAGCCGCGGGGCTGAGCAGG - Exonic
1128504473 15:68256921-68256943 GTCCCACCGCGTCGTGGGGCAGG + Intronic
1130467541 15:84200065-84200087 GCCCCGCCCCAGCGCAGTGCCGG - Intergenic
1130496724 15:84473477-84473499 GCCCCGCCCCAGCGCAGTGCCGG + Intergenic
1130589833 15:85204663-85204685 GCCCCGCCCCAGCGCAGTGCCGG - Intergenic
1132498862 16:275957-275979 GGCGCGGCGCGGCGCGGGGCGGG - Intronic
1132613819 16:830677-830699 GACCCTCCGTGGCGCAGGCCCGG - Intergenic
1132947123 16:2537938-2537960 GCCCCCGCGCGGCGCCGGGCAGG - Intergenic
1136092962 16:27933854-27933876 GTCCCGTAGCTGCTCAGGGCTGG + Intronic
1136406794 16:30052991-30053013 GGGCCGCGGCGGCGCAGAGCCGG + Intergenic
1139750756 16:69107580-69107602 GCCCCGCCTCGGTGCAGTGCCGG - Exonic
1142001744 16:87668210-87668232 ATCCAGCAGCCGCGCAGGGCTGG - Intronic
1142376626 16:89710038-89710060 GACCCTCCTCGGCCCAGGGCAGG + Intronic
1142811797 17:2399018-2399040 GTGCCGCCGCCGCGGCGGGCGGG - Intronic
1144695934 17:17303827-17303849 GGCCCGGCGCGGGGCGGGGCGGG - Intronic
1145265113 17:21376310-21376332 GGCGCGGCGCGGCGCGGGGCGGG + Exonic
1146936766 17:36816847-36816869 GTCCAGCAGCGGGGCGGGGCGGG - Intergenic
1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG + Intronic
1147710320 17:42458837-42458859 GGCCGGCGGCGGCGCAGGGGCGG + Intronic
1148048643 17:44758883-44758905 GTCCTGCCGCGGCGGCGGCCCGG + Intergenic
1148060128 17:44830323-44830345 GTCCCGCCGCGGCCCGGGAGCGG + Intronic
1151612042 17:75182679-75182701 GGCCGGCCGCGGCTCAGGCCCGG - Intergenic
1151705563 17:75765232-75765254 GTCCGGGCGCGGGGCGGGGCTGG - Exonic
1151934643 17:77254471-77254493 GTCCGGCCGGAGCGCAGGGAAGG - Intergenic
1152722089 17:81928162-81928184 GTCCCGGAGCGGCGCGGGGCGGG + Intergenic
1153265253 18:3262616-3262638 GACCCGCCGCGGCGCCGGGAGGG - Exonic
1160818300 19:1046426-1046448 TTCCCGCCGCGGGGAAGAGCGGG - Intronic
1161108785 19:2456979-2457001 GCCCCGCCGCGGCGGGCGGCGGG - Exonic
1161256928 19:3314870-3314892 GGCCCGCCGTGGCCCGGGGCCGG + Intergenic
1161327560 19:3670951-3670973 GCCCCGCCGCGGCCCAGAGCAGG - Intronic
1161327593 19:3671083-3671105 GTCCCGCCCCGGCCCACCGCTGG - Intronic
1161946386 19:7440060-7440082 GACCCGGCGCGGCGCCAGGCTGG - Exonic
1162064893 19:8119343-8119365 GTCCCGCCAGGACTCAGGGCAGG + Intronic
1162339949 19:10086329-10086351 GTCCAGCAGCCGCGCAGGGCAGG - Exonic
1162481379 19:10928852-10928874 GTCCCGGCGCCGCGCAGAGGCGG + Exonic
1162925970 19:13930660-13930682 GGCCCGCCCCGGAGCAGGGAGGG + Exonic
1165668597 19:37655523-37655545 GTCCCGCAGCTGCTCCGGGCCGG + Intronic
1166079391 19:40434136-40434158 CCCCCGCCGCGGAGGAGGGCAGG + Intergenic
1167454611 19:49591690-49591712 ATCCCGCCCCGGCGCCGAGCGGG - Exonic
1167464309 19:49642196-49642218 GCCCCGGCGCGGGGCGGGGCGGG - Exonic
1167464313 19:49642201-49642223 CTCCGGCCCCGGCGCGGGGCGGG - Exonic
1167557520 19:50205436-50205458 GCCCCGTCGCGTCACAGGGCGGG - Intronic
1167744951 19:51345272-51345294 GACCCGCCCCAGCGCACGGCCGG - Exonic
1168056479 19:53867741-53867763 GCCCCGCCTCGGGGCGGGGCTGG + Intronic
924967396 2:91219-91241 GCCTCCCCGCGGGGCAGGGCTGG + Intergenic
925068850 2:950847-950869 GCTCCACCGGGGCGCAGGGCTGG - Exonic
925162801 2:1697823-1697845 GTCCTGCAGCTGCGGAGGGCAGG - Intronic
925730727 2:6917948-6917970 GACCCGCGACCGCGCAGGGCAGG - Intronic
926097517 2:10091645-10091667 GCCGCGCCGCGGGGCAGGGCTGG + Intergenic
926125782 2:10270801-10270823 GGTCCTCCACGGCGCAGGGCTGG - Intergenic
928511769 2:32010086-32010108 GCCCCGCGGCGGCGGCGGGCGGG - Intronic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
934579536 2:95427340-95427362 GCCCCTCCGCCCCGCAGGGCTGG - Intergenic
934599908 2:95649385-95649407 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
936512160 2:113157335-113157357 GGCGGGCGGCGGCGCAGGGCGGG - Intronic
936533251 2:113291389-113291411 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
939003145 2:136758644-136758666 GCCTCCCCGCGGCGCAGCGCTGG + Intergenic
942368648 2:175257135-175257157 GCCTCCCCGCGGGGCAGGGCTGG - Intergenic
942540211 2:177008079-177008101 GCCTCCCCGCGGGGCAGGGCTGG + Intergenic
946397219 2:219449078-219449100 GGCCCGGCGTGGCCCAGGGCAGG - Exonic
948420924 2:237859599-237859621 AGCCCGCCGCGGCGCGGGCCCGG - Exonic
1169143495 20:3238668-3238690 CTCCCACCGCGGCGCCGGACGGG + Intronic
1170524781 20:17226879-17226901 GGCCCGGGGCGGCCCAGGGCGGG + Intronic
1172702766 20:36863176-36863198 GGGCCGCCGCGGCCCAGGCCCGG - Exonic
1173813708 20:45971781-45971803 GTCCCCCCGGGTTGCAGGGCCGG + Intronic
1175992057 20:62794513-62794535 GCCCCACCGCGGGGCGGGGCCGG - Intergenic
1178711020 21:34916810-34916832 ATGCCGCCGCGACCCAGGGCTGG - Intronic
1179674841 21:42974451-42974473 CGCCCGCCGCCGCGCAGGGAGGG + Intergenic
1179908705 21:44436991-44437013 GCCCCGCCGCGGCGCAGGGGAGG + Intronic
1179996771 21:44977795-44977817 GTCCTGCAGCGGGGCTGGGCAGG + Intergenic
1180154773 21:45972573-45972595 TTCCCTTCGCAGCGCAGGGCAGG - Intergenic
1180219964 21:46352302-46352324 GTCCCGGCAGGGCGCAGGGCTGG - Intronic
1181256857 22:21568183-21568205 GGCGCGCTGCGGCCCAGGGCGGG - Intronic
1183222952 22:36528940-36528962 GTCCCTCCGCTGGGCGGGGCAGG - Intronic
1183484701 22:38082623-38082645 GTCCCGGGGAGGCGGAGGGCCGG + Intronic
1183702167 22:39457107-39457129 GCTCCGCCGCCGCGCCGGGCCGG - Intergenic
1183788341 22:40045032-40045054 GTCCCGGCGGGGCGCGGGGGAGG - Intronic
1185259511 22:49853810-49853832 GGCCCCGCGCGGCGCGGGGCGGG - Intergenic
1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG + Intronic
961386082 3:126524209-126524231 CGCGCGGCGCGGCGCAGGGCAGG - Intergenic
961539691 3:127591077-127591099 GTCCGGCCGCGGCCCAGGCCGGG - Intronic
961599885 3:128052393-128052415 GGCGCGGCGCGGCGCGGGGCGGG - Exonic
961652990 3:128426560-128426582 GCCCCGGCGAGGCGCAGCGCGGG + Intergenic
962134759 3:132722202-132722224 GTTCCGCCGAGGCGCGGGGGCGG - Exonic
966808759 3:183825632-183825654 GTGCTGCGGCGGCGCGGGGCGGG - Intergenic
967594898 3:191317140-191317162 GCCTCCCCGCGGGGCAGGGCTGG - Intronic
968372829 4:11298-11320 CTCCCGCCCCGGCGCCGCGCCGG - Intergenic
968879885 4:3293296-3293318 GGCCCGGCGCGGGGCGGGGCGGG + Intronic
969483327 4:7458337-7458359 GTGCCTCAGCGGAGCAGGGCTGG + Intronic
973551270 4:52038196-52038218 GTACCGCCGCGGCCGCGGGCTGG - Intronic
975710593 4:77157290-77157312 GTTGCGCCGCGGCGGAGGGTGGG + Exonic
976830288 4:89307624-89307646 GCCCCGCCGCGCCGCGGAGCCGG - Exonic
979278098 4:118835845-118835867 CTCCCGCCGCGTCCCCGGGCCGG + Intronic
979624278 4:122827597-122827619 GGCGCGCCGCGGCTCCGGGCCGG - Intronic
980130028 4:128809842-128809864 GTTCGGCCGAGGCGCTGGGCTGG - Exonic
984811406 4:183798403-183798425 CTCCAGCCGCGGAGCAGTGCCGG - Intergenic
985783798 5:1883893-1883915 CTCCCGGCGCCCCGCAGGGCTGG + Intronic
986228346 5:5838479-5838501 GTCCAGCCGCGGAGCTGTGCTGG - Intergenic
986315321 5:6583112-6583134 GTCTCCCCGCGGCGCCGCGCAGG + Intergenic
988547715 5:32174037-32174059 CTCCCGCCGAGGCGCCGAGCCGG + Exonic
991772060 5:70049745-70049767 GTTCCGGCGCGGCACAGGCCAGG + Exonic
991851353 5:70925163-70925185 GTTCCGGCGCGGCACAGGCCAGG + Exonic
993529168 5:89003753-89003775 GCCTCCCCGCGGGGCAGGGCTGG - Intergenic
996900583 5:128538275-128538297 GGCCCGGCGGGGCGCGGGGCGGG + Intronic
997582663 5:135027444-135027466 GTCCCGCAGCCGCGGAGGGAGGG + Intergenic
997975437 5:138439181-138439203 GGCCGGGCGCGGCGCGGGGCGGG - Exonic
998467345 5:142356763-142356785 GTCCCGCCGAGGGGGTGGGCAGG - Intergenic
999300204 5:150486159-150486181 GCCCCGGCGCAGCGCCGGGCCGG + Intronic
999300208 5:150486162-150486184 GTCCCGGCCCGGCGCTGCGCCGG - Intronic
1002817316 6:693027-693049 GTCCTGCCGCAGCTCACGGCCGG + Exonic
1002925807 6:1605097-1605119 GGTCCGCTGCGGCGCCGGGCCGG + Intergenic
1003086260 6:3063821-3063843 TTCGCGCGGCGGCGGAGGGCAGG - Intergenic
1003290744 6:4776492-4776514 GCCCCGCCGCGGGGCCGGGCGGG - Exonic
1003585984 6:7389749-7389771 GTCCCGCCCCTGCGCCGAGCTGG - Exonic
1009622441 6:66094805-66094827 GTCCCGCGGCGGGGCAGTGTCGG + Intergenic
1010703241 6:79077572-79077594 TCCCCGCCGGGGCGCGGGGCGGG - Intronic
1015750008 6:136550148-136550170 GAGCCGCGGCGGCGAAGGGCGGG + Intronic
1015785903 6:136921770-136921792 GTCCCGCCGCTGCACCGGGAGGG + Intergenic
1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG + Exonic
1017671907 6:156777528-156777550 GCCCCGCCGGAGCGCCGGGCCGG - Intergenic
1018023960 6:159789641-159789663 GCCCGGCCGCGGGGCACGGCGGG + Exonic
1019157718 6:170050313-170050335 GTGCAGCCGTGGCCCAGGGCAGG - Intergenic
1019410492 7:904604-904626 TGCCCGCCACGGCTCAGGGCGGG + Intronic
1019531092 7:1503909-1503931 GTTTGGCCGCGGCGCTGGGCCGG + Exonic
1020100724 7:5393030-5393052 GTCCCTCCCCCGGGCAGGGCTGG + Intronic
1033361164 7:140640210-140640232 GACCCAGCACGGCGCAGGGCGGG + Intronic
1035187680 7:157139087-157139109 CTCCCGCCCCAGGGCAGGGCTGG + Exonic
1039212692 8:35235343-35235365 GTGACGCGGCGGCGCTGGGCTGG - Intergenic
1039914489 8:41849635-41849657 ATCCCACCGCCGCGCAGGGAAGG + Intronic
1040059738 8:43093762-43093784 GTCCCGCTACCGCGCAGGGGTGG - Intronic
1041369457 8:57143458-57143480 GCCCCGCTGCGGCGGAGGGCAGG - Intergenic
1042857866 8:73285770-73285792 GTCCAGCCTTGTCGCAGGGCTGG + Intergenic
1046661182 8:116949885-116949907 GCCTCCCCGCGGCGCAGGGCTGG - Intergenic
1047760375 8:127949888-127949910 ATCCAGCCGCTGGGCAGGGCCGG - Intergenic
1049348823 8:142153230-142153252 GTCCCGCCATGCCCCAGGGCTGG - Intergenic
1049405393 8:142449941-142449963 GTCCCGGCGAGGCCCAGAGCGGG + Exonic
1049673167 8:143878541-143878563 GCCCCGACGCGGGGCGGGGCGGG + Intergenic
1049801127 8:144517965-144517987 GGGGCGCCGCGGCGCCGGGCGGG + Intergenic
1049973588 9:841902-841924 GTACCGCCGCAGGGCAGAGCCGG + Exonic
1053477444 9:38392690-38392712 GTCCCGCCTCCGCGCAGCCCGGG - Exonic
1056170683 9:83981126-83981148 CTCCCGCCCCGGCGCAAGGCAGG - Intronic
1057432309 9:95005174-95005196 GTCGCGCCGGGGCGGAGTGCGGG + Exonic
1057752414 9:97803495-97803517 GCCCCGCCCCCGCGCTGGGCCGG - Intergenic
1058431722 9:104926686-104926708 GCTCCGCCGCGGGGCTGGGCTGG - Intronic
1061453551 9:130681758-130681780 GCTCCGCGGCGGCGCCGGGCCGG - Exonic
1061818329 9:133208940-133208962 GGCCCCCCGAGGCCCAGGGCCGG - Intronic
1062242122 9:135546418-135546440 GGCCCCCCGAGGCCCAGGGCCGG + Intronic
1062287758 9:135780691-135780713 CTCCCGACGCTGGGCAGGGCAGG - Intronic
1062346677 9:136118356-136118378 GGCGCGGCGCGGCGCAGGCCCGG - Intronic
1062346680 9:136118361-136118383 GGCCCGGCGCGGCGCGGCGCAGG - Intronic
1062499937 9:136847966-136847988 GTCCCGCCGAGGCGGTGGGCAGG + Exonic
1190101128 X:47523816-47523838 CTCCCGCCGCAGCGCTGGGAGGG - Intergenic
1196443790 X:115735161-115735183 GTCCCGCAGTGGGCCAGGGCTGG + Intergenic
1196893323 X:120310613-120310635 ATCCCGCCGCTGCAGAGGGCAGG + Intronic
1197749951 X:129957403-129957425 CTGTCGCCGCGGCGCAGGGCCGG - Intergenic