ID: 1016272936

View in Genome Browser
Species Human (GRCh38)
Location 6:142311200-142311222
Sequence AAGTGTAAGTACTTTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016272936 Original CRISPR AAGTGTAAGTACTTTGATTC TGG (reversed) Intronic
901952628 1:12760834-12760856 AAGTATAAGTGCTCTGCTTCAGG - Exonic
908882985 1:68754108-68754130 AATTCCAAGTACTTTGAATCTGG - Intergenic
909300481 1:74007015-74007037 AAGAGTAAGTACTTAGATGATGG + Intergenic
909830761 1:80186709-80186731 AAGTGTGAGCACTTTAAATCTGG + Intergenic
913707510 1:121441564-121441586 AAGTGTATATATTTTGATACAGG - Intergenic
1062950344 10:1495060-1495082 AATTTTAAATAGTTTGATTCTGG + Intronic
1064666032 10:17652849-17652871 AAGTGGAAGTGCTCTGATTGAGG - Intronic
1071808777 10:89155145-89155167 AAATGTCAGTACTTTGAATCAGG - Intergenic
1072793563 10:98337060-98337082 AAGTGTAAGTAACTTGCTTAAGG - Intergenic
1073530302 10:104224801-104224823 AAATGTAAGTACCTAGATTCAGG - Intronic
1075606077 10:123810596-123810618 AAGTGTAAGTACCTTATTTTTGG - Intronic
1078124082 11:8542138-8542160 AATAGTAGGTTCTTTGATTCAGG + Intronic
1079548007 11:21658587-21658609 AAGCAAAAGTAATTTGATTCCGG - Intergenic
1080914917 11:36647541-36647563 AAGTTAAAGTACTTTCCTTCTGG + Intronic
1080927004 11:36768046-36768068 AAGTGTAAGGCCATTGATGCAGG + Intergenic
1082245582 11:49918282-49918304 GAGTGCAAGTACTTTTATTTGGG + Intergenic
1086268933 11:85036053-85036075 AAGACTAAGTAATTTGCTTCAGG - Intronic
1088048517 11:105481777-105481799 AAGTTTCAGTTCTTGGATTCAGG + Intergenic
1088932215 11:114363756-114363778 ATGTATAAGTACTGTGCTTCGGG + Intergenic
1090439626 11:126714777-126714799 AAATGCAAGTAGTTTGTTTCAGG - Intronic
1091416333 12:289010-289032 AAATGCAAATACTTTGATTGAGG + Intronic
1093779912 12:23123030-23123052 AGGTGGAAGTAGTTGGATTCTGG + Intergenic
1094532057 12:31285618-31285640 AAGAGGAAGTACTTTGTTTAAGG - Intronic
1095336143 12:41028972-41028994 AAGTATAAGCATTTTTATTCTGG + Intronic
1095794687 12:46205428-46205450 AAATGTATTTACTTTAATTCTGG - Intronic
1097373072 12:58807667-58807689 AAATGTAAGGTCTTTGAGTCTGG + Intronic
1100375404 12:94011031-94011053 AAGTTTAAATACTTTGAATGTGG - Intergenic
1102520701 12:113476237-113476259 AAGTGTAATTATTTTGTTTGGGG + Intergenic
1105551260 13:21398085-21398107 AAGTTTAAGTATCTTGATTCTGG + Intronic
1108881147 13:55117926-55117948 AAGTGAAAGTATTTTCTTTCAGG - Intergenic
1114434802 14:22696847-22696869 TGGTGTAAATACTTTCATTCTGG - Intergenic
1114757587 14:25277670-25277692 AAGTATAAGTAGTTTGACCCAGG + Intergenic
1117320279 14:54615508-54615530 CACTGTAAGTACTATGTTTCAGG + Intronic
1117973739 14:61278057-61278079 AAGTTAAAGTATTCTGATTCTGG - Exonic
1120925264 14:89791665-89791687 AAATCTAAGTAACTTGATTCAGG - Intergenic
1124155579 15:27222516-27222538 GATTCCAAGTACTTTGATTCGGG + Intronic
1124918941 15:34005764-34005786 AAGTGTATGAAAGTTGATTCAGG - Intronic
1124951988 15:34331887-34331909 AAGTGTAACAACTTTGAGACTGG - Intronic
1135152506 16:20021303-20021325 ATGTGTAACTACTTTGATTTTGG + Intergenic
1141859680 16:86708043-86708065 AAGTGTATGGACTCTGATTTCGG + Intergenic
1143988951 17:10940515-10940537 AAGTCTCAGTACTAAGATTCTGG + Intergenic
1146784650 17:35708412-35708434 TACAGTAAGTACTTTTATTCAGG - Intronic
1149098884 17:52879810-52879832 AAGTGTCTGTACATTTATTCTGG - Intronic
1149829330 17:59857511-59857533 AAGTGTAATTTCTTAGATTATGG - Intergenic
1153665533 18:7364716-7364738 AAGTTTAAATACTTTAATTTGGG + Intergenic
1158589157 18:58765176-58765198 AAGTGTTAGCATCTTGATTCTGG - Intergenic
1159222885 18:65488243-65488265 AAATGTAAGAAGTTTTATTCTGG - Intergenic
1159423888 18:68258756-68258778 AAATGTAACTGCTTTTATTCTGG + Intergenic
1159699284 18:71604589-71604611 AAGTGCAAACACTTTCATTCTGG - Intergenic
1162445642 19:10720852-10720874 ACGTGAAAGCACTTTCATTCTGG - Intronic
1165297956 19:34943710-34943732 CAGTGTGAGTACTCTGATGCCGG - Exonic
1166648892 19:44555259-44555281 AACTGTAAGAACCTGGATTCTGG + Intergenic
925517351 2:4698063-4698085 AAGTGTAAGTAATTTTACTGTGG - Intergenic
925676199 2:6363726-6363748 AATTGTAAGTTCATTCATTCAGG - Intergenic
926907930 2:17823505-17823527 AAGTTTAAAAACTTGGATTCTGG - Intergenic
926993641 2:18708761-18708783 AAGTTTAAGTTATTTGATTGAGG - Intergenic
933330750 2:80890235-80890257 GAGTGTAAGTACTTTCATTTGGG + Intergenic
936849657 2:116880314-116880336 AAATGTAAATACTATGATACAGG + Intergenic
941966334 2:171304550-171304572 ATGTGTAACTCCTTTGCTTCAGG + Intergenic
942334795 2:174871790-174871812 AAATGTAAGTTCTTTGAGACAGG + Intronic
943500774 2:188686601-188686623 AAGTGCAAGAGCTTTCATTCGGG - Intergenic
944141944 2:196466310-196466332 AAGTGTAAATATTTTCATTGTGG - Intronic
946199582 2:218064092-218064114 AAGTGTAAGTACAGCGAATCTGG - Intronic
1170151907 20:13235407-13235429 AAGTGTAAGGATTTTGCTTAGGG - Intronic
1171838676 20:30182263-30182285 CAGTAAAAGTACTTTGAGTCTGG - Intergenic
1173940123 20:46903792-46903814 GAGTCTAAGTAATTTGCTTCAGG - Intronic
1174220944 20:48955014-48955036 AAGTGGAAGCACTTTTATGCAGG - Intronic
1175269039 20:57720799-57720821 AAGGGTAAGTGCGTTGATGCAGG + Intergenic
1177132923 21:17279443-17279465 AGTTGTAAGTCCTTTGATACAGG + Intergenic
949262467 3:2118210-2118232 AAGAGTAAGTAATTTGTCTCAGG + Intronic
950210535 3:11119732-11119754 TAGTGTAAGTATTTTGTTTGGGG - Intergenic
952696543 3:36270972-36270994 AAGTTTTAATACTTTGAATCAGG - Intergenic
955690149 3:61582810-61582832 ATGTGTTAGCACTTTGCTTCGGG + Intronic
957320692 3:78626370-78626392 CAGTGTATGTAATTTGAATCTGG + Intronic
957857743 3:85899748-85899770 AATTGTAAGGATTTTGGTTCTGG + Intronic
957968850 3:87357575-87357597 AACTGTAAGTAATTTAATACCGG + Intergenic
958483672 3:94676574-94676596 AAGAGTAAGATCTCTGATTCAGG - Intergenic
961956833 3:130813325-130813347 AAGTGCAAGTAGTTTATTTCTGG - Intergenic
964900378 3:161652177-161652199 AAGAGTAAGGTCTTTAATTCTGG - Intergenic
966027858 3:175307878-175307900 AAGTGAAAGTAATTTGTTACAGG - Intronic
970093838 4:12439683-12439705 AAGTGTAAGGACCTGGGTTCTGG - Intergenic
971008869 4:22407373-22407395 AATTGAAAATAATTTGATTCAGG - Intronic
971718057 4:30206478-30206500 AATTATAAGTACTTTGCTTTTGG + Intergenic
972098827 4:35385341-35385363 AATTGTAAGGACTTTGAATCAGG + Intergenic
972765370 4:42149135-42149157 AAGTGTAATTGCTGTGTTTCAGG - Intronic
974711578 4:65603858-65603880 AAATGTAAGTAGTTTAATTATGG - Intronic
977943332 4:102881584-102881606 GACTGTAAGTACATTTATTCAGG - Intronic
979295313 4:119026313-119026335 ATCTGTAAGTACTTGGAATCTGG - Intronic
981895259 4:149791096-149791118 AAGTGCAAGTAATTTTATTCAGG + Intergenic
982850485 4:160309157-160309179 AAGTGCAAGAACAGTGATTCTGG + Intergenic
982978674 4:162102524-162102546 AAGAGAAAGTACTGTGTTTCAGG - Intronic
983763373 4:171443117-171443139 AAGTGTAAGGAATTTAGTTCTGG + Intergenic
990488352 5:56280539-56280561 AAGTGTAAGTACTATCATGCAGG + Intergenic
991540900 5:67726982-67727004 AAGTATAAGTTCTTGAATTCTGG + Intergenic
991772122 5:70050132-70050154 GAGTGAAAGTATTTGGATTCTGG + Intronic
991851415 5:70925550-70925572 GAGTGAAAGTATTTGGATTCTGG + Intronic
992086449 5:73282333-73282355 AAGTTTAAATTCCTTGATTCGGG - Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993728024 5:91390489-91390511 AATTCTAAGTATTTTGTTTCAGG + Intergenic
993832742 5:92779652-92779674 AAATGTAAATCCTTTGACTCAGG + Intergenic
994214227 5:97119428-97119450 AAGTGTAAGCACATTGCTTTAGG + Intronic
996914488 5:128695821-128695843 AAGTGTAATGAGATTGATTCTGG + Intronic
997390936 5:133514864-133514886 AAGGGAAAGTACTTTTATTTAGG + Intronic
998354410 5:141522851-141522873 ATGGGTAAGAACTTTGACTCGGG + Intronic
1000714478 5:164623552-164623574 AAGTGCAAAGACTTTGATTGAGG + Intergenic
1007750923 6:44071147-44071169 AAGTGTATGTTCTTGGATTGGGG - Intergenic
1007869307 6:45015116-45015138 ATGTGTGAGTATTGTGATTCTGG - Intronic
1008581597 6:52913179-52913201 AAATGTAAGTGCTTTTTTTCTGG + Intergenic
1010771621 6:79838565-79838587 AAGGGTGAATACTTCGATTCTGG - Intergenic
1011450662 6:87488755-87488777 ATGTGTAAGAACTTTGAGCCTGG + Intronic
1012902878 6:105028266-105028288 CATTTTAAGGACTTTGATTCTGG + Intronic
1016272936 6:142311200-142311222 AAGTGTAAGTACTTTGATTCTGG - Intronic
1016760439 6:147730405-147730427 AGCTGTAAGTACTTGGATTCTGG + Intronic
1019112587 6:169728091-169728113 AAGTTTACCTACTTGGATTCAGG + Intergenic
1020195688 7:6036872-6036894 GAGTATAAGTACTTTTTTTCAGG - Intronic
1023072979 7:36456099-36456121 GAGTGTAAGTATGTGGATTCTGG - Intergenic
1023444423 7:40216950-40216972 AAGTGTAAGTATTTTCTTTGTGG + Intronic
1024084603 7:45882975-45882997 AAGGGTAAAGGCTTTGATTCGGG + Intergenic
1026166349 7:67913302-67913324 AATTGACAGTACTTTGAGTCAGG + Intergenic
1027459474 7:78435011-78435033 AAGTTTAAGAGCTTGGATTCTGG + Intronic
1028245011 7:88466492-88466514 AAGTGTAGGTAGTTTGAGGCAGG + Intergenic
1030712681 7:112769654-112769676 AAATGTAAGTACTTTGAATCTGG - Intronic
1031559741 7:123224270-123224292 ATGTGTAATCACTTTGATTGTGG - Intergenic
1031641493 7:124170229-124170251 AATTGTAAATAGTTTGTTTCTGG + Intergenic
1035527097 8:322493-322515 AAGTGTAACTACTTATATGCTGG + Intergenic
1036571860 8:9986701-9986723 AAGTGTAAGGATGTTGTTTCAGG - Intergenic
1036618872 8:10409716-10409738 AAGTGAAAGTCCTGTGTTTCTGG - Intronic
1036699633 8:11003677-11003699 AACTGTAAGAACTGGGATTCTGG + Intronic
1038503148 8:28062242-28062264 AAGTGAATGGACTTTGATTTAGG + Intronic
1039136401 8:34328125-34328147 AAATGTAAGTAAATAGATTCTGG + Intergenic
1042095986 8:65216631-65216653 TAGAGTAAGTACTTTGTTCCTGG + Intergenic
1043313355 8:78889985-78890007 ATTTATAAGTACTTTGTTTCTGG + Intergenic
1043572905 8:81625448-81625470 AACTGTTAGCACTGTGATTCTGG - Intergenic
1043920346 8:85975507-85975529 GAGTGTTAGTACTTTGAGTTGGG + Intergenic
1044430377 8:92101697-92101719 AAGTTTGAGTACTATGATTCCGG - Intronic
1046018654 8:108636801-108636823 AAGTGAAAGTGCTTTGATTCTGG + Intronic
1047253602 8:123199167-123199189 AAGTGTAAATACTTCGCTGCTGG + Intronic
1049134829 8:140887011-140887033 AAGTGTCAGTACCGTGCTTCAGG - Intronic
1049723624 8:144134423-144134445 ATCTGTCAGTACTTTGATCCTGG - Intergenic
1051560075 9:18430842-18430864 AATTGTAAGTACTTTTAATTGGG + Intergenic
1054916840 9:70502305-70502327 AAGAGGATATACTTTGATTCTGG - Intergenic
1055148011 9:72959395-72959417 AAGTGTAATGACTTAGAATCTGG - Intronic
1056073426 9:83013335-83013357 AAGTCTAAGTGCTTTGATTCTGG + Intronic
1057490944 9:95518941-95518963 GAGTGTAAGTACTTAGAGTTGGG + Intergenic
1058664557 9:107298624-107298646 AAATGTAAGTACATTGGGTCAGG - Intronic
1188076955 X:25789347-25789369 AATTGTAAGAACTTTTATTATGG - Intergenic
1188273071 X:28166479-28166501 CAGTTTAAGTACCTAGATTCTGG + Intergenic
1191920518 X:66251719-66251741 AAGTGTAAATACCTTGAGACAGG + Intronic
1197419696 X:126223575-126223597 CAGTGAGAGTTCTTTGATTCTGG - Intergenic