ID: 1016273416

View in Genome Browser
Species Human (GRCh38)
Location 6:142318686-142318708
Sequence ATGGATCTAGAAATGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 399}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016273416 Original CRISPR ATGGATCTAGAAATGGAGAA GGG Intronic
901219778 1:7576929-7576951 ATGGCTCTGAAAGTGGAGAAAGG + Intronic
902261431 1:15227655-15227677 ATGGATGGAGAAAAGGAGAAAGG - Intergenic
903697657 1:25220210-25220232 AAGTACCTAGAAATGGAGAAGGG - Intergenic
903965281 1:27084838-27084860 ATGAATCTAGAAAGGGAAATAGG - Intergenic
904033306 1:27546561-27546583 AGGGACCCAGAAGTGGAGAAGGG - Intronic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
906315158 1:44782166-44782188 AAGGTGGTAGAAATGGAGAATGG - Intergenic
906657993 1:47562573-47562595 ACCGATCTAGGAAAGGAGAAAGG - Intergenic
908790191 1:67773438-67773460 AGGGACCCAGAAATGGACAATGG + Intronic
908870341 1:68603372-68603394 AAGGGTCTAGAAATTGACAAAGG - Intergenic
910266629 1:85344793-85344815 ATGGATCTAGAAAAAGAACAAGG + Intronic
911509662 1:98795756-98795778 ATGGAAATAAAAATGGACAAAGG - Intergenic
912245259 1:107955427-107955449 ATGGCACTAGAAATGGACACAGG - Intronic
912974876 1:114320144-114320166 AAGCAGATAGAAATGGAGAAAGG + Intergenic
913556168 1:119969473-119969495 ACGGATCTAGAAACAGGGAAGGG - Intronic
914329750 1:146655813-146655835 ATGGACTTGGAAATGGTGAAAGG + Intergenic
914760793 1:150596429-150596451 ATTGATCTAGAACTGGGGAGGGG + Intergenic
914779496 1:150772132-150772154 ATGGATTTAGAAATAAACAAAGG - Intergenic
914973191 1:152330465-152330487 ATGGAACATGAAATGGTGAATGG - Intergenic
915140122 1:153762647-153762669 ATGCTTCTAGGAAGGGAGAATGG - Intronic
915405331 1:155655894-155655916 AGGGATCTAAAATTGGAAAATGG - Intergenic
915467184 1:156104590-156104612 ATGGATCCAGGAGTGGAGGATGG - Intronic
916503718 1:165408858-165408880 ATGGAGGTAGAAAGGGACAACGG + Intronic
917474787 1:175359870-175359892 ATGGAACCAGAAGAGGAGAAAGG - Intronic
918338889 1:183550840-183550862 ATGGGTCCAAAATTGGAGAATGG - Exonic
921246842 1:213252377-213252399 ATGGATTTAGGAGTAGAGAAAGG - Intronic
921405992 1:214780186-214780208 AAGCATCTAGAAAAGCAGAAAGG + Intergenic
923316102 1:232781295-232781317 ATAGGGCTAGAAATGGTGAAAGG - Intergenic
923653047 1:235891688-235891710 TTGGATCCTGAAATGGAAAAAGG + Intergenic
924527336 1:244863976-244863998 ATGGAGCTAGGAGAGGAGAACGG - Exonic
1063112324 10:3047821-3047843 AGGGAGATAGAAAGGGAGAAAGG - Intergenic
1064754264 10:18560307-18560329 ATGGATAATGGAATGGAGAATGG + Intronic
1064755356 10:18568049-18568071 ATGGAACGGAAAATGGAGAATGG - Intronic
1064755367 10:18568151-18568173 ATGGATAATGGAATGGAGAATGG - Intronic
1065412255 10:25442718-25442740 ATGGACTTAGCTATGGAGAAAGG - Intronic
1068206830 10:53865163-53865185 ATGGATATAGGTCTGGAGAAAGG + Intronic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069030109 10:63587322-63587344 AATGATTGAGAAATGGAGAAGGG - Intronic
1069098567 10:64289948-64289970 GTGGACCTAGAAATGATGAATGG - Intergenic
1069185727 10:65420268-65420290 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1070637908 10:78143887-78143909 ATGGATCTAACAGTGGGGAATGG + Intergenic
1070759388 10:79014292-79014314 TTGGATGTAGAAATTGGGAAAGG - Intergenic
1071687318 10:87773366-87773388 AAGGAAATAGAAATAGAGAACGG - Intronic
1073796188 10:106990716-106990738 ATGCAGGTAGAAATGGAAAATGG - Intronic
1073807832 10:107118678-107118700 AAGGAAGTAGAAATGGATAAGGG - Intronic
1073883041 10:108006195-108006217 ATGTAACTGAAAATGGAGAATGG + Intergenic
1076290029 10:129338881-129338903 ATGCACCAAGAAATGGGGAATGG - Intergenic
1076458203 10:130619033-130619055 ATGGAACAGGAAAGGGAGAATGG - Intergenic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077345097 11:2044048-2044070 TGGGATATAGAAATGGATAAAGG - Intergenic
1077722406 11:4642002-4642024 ATGTATCTTGGAATGGAGGAGGG + Intergenic
1077931849 11:6741056-6741078 AAGGATAAAGAAATGGAAAAAGG + Intergenic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079250890 11:18786764-18786786 ATGGATCTACAGGTGGAGATGGG - Intronic
1079535044 11:21503971-21503993 CTGGATCTAGCACTGGACAAGGG - Intronic
1080980485 11:37398267-37398289 AAGGATCTACAAATGGTCAAGGG + Intergenic
1082626449 11:55492924-55492946 ATTGATCTAGATATACAGAATGG - Intergenic
1082766916 11:57176693-57176715 ATGGAGGAAGAAATGGAAAAAGG - Intergenic
1083311762 11:61787422-61787444 ATGGGTCCAGAAATGGGAAAGGG + Exonic
1084021062 11:66418592-66418614 AAGGGTCTAGAAAGGGACAAGGG - Intergenic
1085429689 11:76437333-76437355 ATGAACCCAGAAATGGAGAAAGG - Intergenic
1087173160 11:95070930-95070952 ATGGGTGTAGAAATTGAGAAAGG + Exonic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1089093802 11:115901003-115901025 AGGAATCTAGAAAGGGAGCAAGG - Intergenic
1089850300 11:121490151-121490173 AAGGAGCTAGAACTGGAGAAAGG - Intronic
1090570963 11:128045028-128045050 ATCCATGTAGACATGGAGAATGG + Intergenic
1091038213 11:132252866-132252888 ATGGATCTCCAAATGGGAAATGG - Intronic
1202828026 11_KI270721v1_random:98920-98942 TGGGATATAGAAATGGATAAAGG - Intergenic
1092314956 12:7400848-7400870 ATGGTTCTAGAAATAGAAGAGGG + Intronic
1092336216 12:7636295-7636317 CTGGATCCAGAAAGGAAGAAAGG + Intergenic
1092739917 12:11618246-11618268 ATGCCTCTAGAAATTGTGAAAGG + Intergenic
1093553383 12:20442020-20442042 ATGGATCCAGAAATGCAAAAGGG - Intronic
1094604765 12:31940704-31940726 AGGGATCTGCAATTGGAGAATGG - Intergenic
1094812415 12:34151479-34151501 AGGGAGCTAGAAAAGGAGATGGG - Intergenic
1095533461 12:43218618-43218640 ATAGATCTAGAAGTGGTGAAGGG - Intergenic
1095796739 12:46227349-46227371 ATGGATCTAGCAAAGAAGAGAGG + Intronic
1096402404 12:51318143-51318165 ATGAAGCTAGAAAGGGAGACTGG + Intronic
1096541737 12:52311732-52311754 ATGGAGCTGGAAAAGGAGCATGG - Intergenic
1096741484 12:53696941-53696963 CTGGATCTTGAAATGGAGGAGGG - Intergenic
1096858060 12:54499696-54499718 ATGAATCTTGCAATGGAAAAGGG - Intronic
1097960184 12:65524644-65524666 AAGGAAATATAAATGGAGAATGG - Intergenic
1098598863 12:72305600-72305622 ATGTACCTACAACTGGAGAAAGG + Intronic
1100125485 12:91419765-91419787 ATTGATCAAGAAAGGCAGAATGG + Intergenic
1100669774 12:96799050-96799072 ATGGATATAGATATGAATAAAGG - Intronic
1102806882 12:115789651-115789673 AGGGATCTTGAGATGTAGAATGG - Intergenic
1104114874 12:125739675-125739697 AAGAATCTACAAATGTAGAATGG + Intergenic
1104129042 12:125874881-125874903 ATGGAACTTGGGATGGAGAAAGG + Intergenic
1104453007 12:128886601-128886623 ATGGCTCTGGACATGGAGGAAGG - Intronic
1106273319 13:28176100-28176122 ATGGTAGTACAAATGGAGAAAGG + Intronic
1107553589 13:41498603-41498625 AGGGATCAAGGAATGTAGAATGG - Intergenic
1108868092 13:54946480-54946502 AATGATCTATAAATGGAGAATGG - Intergenic
1109102943 13:58209474-58209496 ATGGATCTGGAAAGGAAGGAAGG + Intergenic
1109633820 13:65086454-65086476 AAGTATCTATAAATGTAGAAAGG + Intergenic
1110280576 13:73688920-73688942 ATGGATGTAGAAATAGTAAACGG - Exonic
1110392714 13:74993939-74993961 ATGGAGGTAGTAATGGAGTAAGG - Intergenic
1110706911 13:78607716-78607738 ATGGAGGAAGGAATGGAGAAAGG + Intergenic
1111329978 13:86752723-86752745 AAGGATATAGAAATAGATAAAGG + Intergenic
1111599326 13:90451592-90451614 AAGGATCTAGAAAAGAAGACTGG - Intergenic
1111674855 13:91374797-91374819 ATGGAGGAAGAAAGGGAGAATGG + Intergenic
1112936414 13:104805275-104805297 ATGAATATAGAAATGGAAATTGG - Intergenic
1112940272 13:104853577-104853599 ATGTATATAGAATAGGAGAAAGG + Intergenic
1113049431 13:106193009-106193031 CAGGAGTTAGAAATGGAGAAAGG + Intergenic
1113077736 13:106484507-106484529 ATAGTTTTGGAAATGGAGAATGG + Intergenic
1113352747 13:109545343-109545365 ATGGATTTAGAATTGCAGAAAGG - Intergenic
1113354571 13:109566307-109566329 ATGCAGCTTGAAGTGGAGAACGG - Intergenic
1114158995 14:20141627-20141649 AAGGAACTAGAAAGAGAGAAGGG - Intergenic
1114275849 14:21143386-21143408 ATGGTTCTAGAGGTGGGGAAGGG - Intergenic
1114943326 14:27644469-27644491 ATGCATGAGGAAATGGAGAAAGG + Intergenic
1115519001 14:34214177-34214199 ATGATTCTAGGAATGGGGAAGGG - Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1119142669 14:72281824-72281846 ATGCATCTGGAAAGGTAGAAAGG + Intronic
1120278910 14:82414092-82414114 AAGGATGTTGAAAAGGAGAAAGG + Intergenic
1120389029 14:83882005-83882027 ATGCATTTTGAAAGGGAGAAGGG - Intergenic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1122083206 14:99281233-99281255 CTGGATCGAGACATGGAGGAAGG + Intergenic
1122192735 14:100059773-100059795 ATGGAAATAGAACTGAAGAAAGG + Intronic
1123167753 14:106342755-106342777 ATGGATCTGGAGATGGTGACTGG + Intergenic
1123170379 14:106367466-106367488 ATGGATCTGGAGATGGTGACTGG + Intergenic
1123194061 14:106599729-106599751 ATGGATCTGGAGATGGTGACTGG + Intergenic
1124051434 15:26200474-26200496 ATGCATATGGAAATGGAGGAGGG - Intergenic
1124160324 15:27262415-27262437 AGGGAAGTAGAGATGGAGAAAGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126522263 15:49608354-49608376 ATAAAACTAGAGATGGAGAAGGG + Intronic
1126956937 15:53943121-53943143 ATGGAGGTTGGAATGGAGAATGG - Intergenic
1127747697 15:61997431-61997453 CTGGATATAGAAATGTAGGAAGG - Intronic
1127965593 15:63920593-63920615 ATGCATATAGAAAAGGAGACAGG + Intronic
1128121816 15:65154634-65154656 ATGGATCTAGGAATCAAGGAAGG - Intronic
1128930092 15:71696642-71696664 ATAGATCAAAAAAGGGAGAAAGG + Intronic
1129819068 15:78584140-78584162 AGGGCTCTGGAGATGGAGAATGG + Intronic
1130840034 15:87689959-87689981 ATGAATATAGAGCTGGAGAATGG - Intergenic
1131804995 15:96112430-96112452 ATTGATAAAGAAATGGTGAATGG - Intergenic
1133733748 16:8597958-8597980 ACGGATCTAGAAATGTGAAAGGG - Intergenic
1135528843 16:23235087-23235109 ATTGATGTAAAAATGGATAAGGG - Intergenic
1138317452 16:56082432-56082454 TTGGATCTGGAACTGGATAATGG - Intergenic
1140003810 16:71055120-71055142 ATGGACTTGGAAATGGTGAAAGG - Intronic
1140881365 16:79200742-79200764 GGAGATCTAGAAATGGTGAAAGG + Intronic
1142482962 17:229819-229841 GTGGGTCTGGAAAGGGAGAAAGG + Intronic
1148979043 17:51555285-51555307 AAGAATGTAGAAAGGGAGAAAGG - Intergenic
1150951327 17:69805089-69805111 ATGGATATAGAAAAAGAGAGGGG + Intergenic
1151792467 17:76317013-76317035 ATTGAACTAGAAATAGACAAAGG - Intronic
1152458082 17:80427438-80427460 AAGCATCTAGAAATAGAGCAAGG + Intronic
1152988175 18:338262-338284 AAGGGGCTAGACATGGAGAAGGG - Intronic
1157842633 18:50973372-50973394 ATGTACCTAGAAATAGTGAAAGG + Intronic
1157914349 18:51650139-51650161 ATGCATCTAGAAGAAGAGAAGGG + Intergenic
1157989049 18:52473388-52473410 ATTGAGTTAGAAATGGAGGAAGG - Intronic
1158131758 18:54159790-54159812 ATGGATATTGAAATGGACAGTGG - Exonic
1159528543 18:69626400-69626422 ATGAATAAAGAAATGAAGAAAGG - Intronic
1161592928 19:5136832-5136854 CTGGGTCTGGAAATGGGGAAAGG - Intronic
1162807178 19:13144134-13144156 CTGGAACTGGAAATGGAGACAGG + Exonic
1164201507 19:23022811-23022833 ATGGGTCTATAAAAGCAGAAAGG - Intergenic
1164712369 19:30366554-30366576 ATAGATCTAGAGAGGAAGAAAGG - Intronic
1166571775 19:43801810-43801832 AGGGAATTAGAAATGTAGAAAGG - Intronic
1166625547 19:44350772-44350794 ATGGACTTTGAAATGCAGAAAGG - Intronic
1167601202 19:50455824-50455846 ATGGATGTAGAAAGGAAGAAGGG - Intronic
1167718803 19:51163152-51163174 ATTGATCAAGAAATGGAGAAAGG + Intergenic
1167981056 19:53276157-53276179 AAGGAACTTGAAATGGAGAAAGG + Intergenic
924997718 2:378787-378809 ATGAAACTAGAAATAGATAATGG + Intergenic
925223002 2:2158000-2158022 AGAGACCTAGGAATGGAGAAAGG - Intronic
926624580 2:15080568-15080590 ATGGATCAAGAACTTGAGCAAGG + Intergenic
929232417 2:39573217-39573239 ATGGATATAGAAATAGTGGAGGG + Intergenic
931095289 2:58933164-58933186 AGGGATCTAGAAATACAGTAGGG + Intergenic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
931916452 2:66961959-66961981 ATGGAACTAGAAACAGAGATGGG - Intergenic
933123680 2:78575999-78576021 ATGAATCTAGGAATTCAGAATGG + Intergenic
933592052 2:84243831-84243853 AAGGTGCTGGAAATGGAGAATGG + Intergenic
933970901 2:87468964-87468986 ATGGATGAGGAAATGGAGATTGG + Intergenic
935534054 2:104272400-104272422 AAGGATCAAGAAATGGTGCAAGG - Intergenic
935898119 2:107759703-107759725 ATGGGTCTAGAAGTAAAGAAGGG + Intergenic
936322825 2:111481225-111481247 ATGGATGAGGAAATGGAGATTGG - Intergenic
936534340 2:113300379-113300401 ATGAATCTTGAATTGGAGATGGG - Intergenic
936652759 2:114448432-114448454 ATGGGTCTACAAATGAAGCATGG + Intronic
936949686 2:117965479-117965501 ATGGGGTTAGAAATGGAAAAGGG - Intronic
937611236 2:123864028-123864050 ATGATATTAGAAATGGAGAATGG + Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
939859931 2:147407071-147407093 AAAGTTATAGAAATGGAGAATGG + Intergenic
939904883 2:147900243-147900265 AGAAATCTAGAAATGGAGGAGGG - Intronic
940139952 2:150483040-150483062 ATGGATGGAGAAAGGGAGAAAGG + Intronic
941301229 2:163804534-163804556 TTTGATCTAGAATTAGAGAAGGG + Intergenic
941684845 2:168437925-168437947 ATGGATCAGGAAAGAGAGAAGGG + Intergenic
942250991 2:174047755-174047777 GGCAATCTAGAAATGGAGAAAGG - Intergenic
942545914 2:177063497-177063519 ATGGATGGGGAAATGGAGGAGGG - Intergenic
943252417 2:185544306-185544328 ATGGATATATAAATGGTGATTGG + Intergenic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
944027552 2:195189794-195189816 ATGGCTTTAAAAATAGAGAAAGG + Intergenic
944761231 2:202816653-202816675 TGGGATTCAGAAATGGAGAAAGG - Intronic
944879953 2:204002601-204002623 ATGGATTTAGAAAAGAAGAAAGG + Intergenic
945895557 2:215477717-215477739 TTGGATAAAGAAATGCAGAAAGG - Intergenic
946176572 2:217925733-217925755 AAGTTTCTAGAAATGGATAATGG - Intronic
946605566 2:221400434-221400456 ATGGATCAGGAATTGGAGAGAGG + Intergenic
946685010 2:222259275-222259297 ATGTATCAGGAAGTGGAGAATGG - Intronic
948014534 2:234677309-234677331 CTGGATCTAGGAATACAGAAAGG - Intergenic
948711792 2:239829713-239829735 ATGGATTTAGAAAAGGAAAGAGG - Intergenic
1169085223 20:2822024-2822046 ATTGATCAAGGAATGGAGAAGGG + Intergenic
1169948348 20:11013867-11013889 GTGGAGCTAGAAATGCTGAAGGG + Intergenic
1170281661 20:14655959-14655981 CTGGAAATAGAAATGAAGAAAGG + Intronic
1170445576 20:16424057-16424079 AGGGCTCTAGCAATGTAGAATGG - Intronic
1171227117 20:23451190-23451212 ATGGATGAAGAAATGAAGCAAGG - Intronic
1172169433 20:32920151-32920173 ATGAAACGAGAAAAGGAGAATGG + Intronic
1173577743 20:44123972-44123994 ATGGATCCAGAGATGGTGAGTGG - Intronic
1173871520 20:46344999-46345021 ATGGATGGAGAGATGGATAATGG - Intergenic
1176153653 20:63607034-63607056 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153660 20:63607067-63607089 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153667 20:63607100-63607122 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153685 20:63607201-63607223 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153692 20:63607234-63607256 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153718 20:63607370-63607392 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153733 20:63607436-63607458 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153753 20:63607539-63607561 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153761 20:63607573-63607595 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153789 20:63607711-63607733 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153818 20:63607848-63607870 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153941 20:63608492-63608514 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153955 20:63608560-63608582 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153975 20:63608662-63608684 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153989 20:63608730-63608752 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154003 20:63608798-63608820 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154031 20:63608935-63608957 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154119 20:63609416-63609438 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154140 20:63609518-63609540 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154153 20:63609585-63609607 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154167 20:63609652-63609674 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154174 20:63609685-63609707 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154188 20:63609754-63609776 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154196 20:63609788-63609810 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154223 20:63609926-63609948 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154231 20:63609960-63609982 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176926060 21:14750324-14750346 ATGGAATAAGAAATGGACAAAGG + Intergenic
1177108594 21:16994695-16994717 ATGGAAAAAGAAATGGAAAATGG - Intergenic
1177192056 21:17862978-17863000 ATGGAATAAGTAATGGAGAAGGG + Intergenic
1177362303 21:20088526-20088548 TTGGTTATAGAAATGGAGACAGG + Intergenic
1177568306 21:22852456-22852478 ATGGAACAAAAACTGGAGAAAGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1179463629 21:41555863-41555885 GTGAATCTTGAACTGGAGAATGG - Intergenic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179598873 21:42462211-42462233 AAGGAAATAGAAATGTAGAAAGG + Intergenic
1179606657 21:42520613-42520635 GTCGATATAGAAATAGAGAAGGG + Intronic
1180338468 22:11599801-11599823 AAGGATCAAGAAACAGAGAAAGG - Intergenic
1181315971 22:21971091-21971113 TTGCATCTGGGAATGGAGAATGG - Intronic
1182085862 22:27560842-27560864 AACGCTATAGAAATGGAGAACGG + Intergenic
1182142199 22:27969373-27969395 ATGTATATGGAAATGCAGAAGGG - Intergenic
1182773682 22:32815151-32815173 ATGAAACTAGAAATGGGGAGGGG - Intronic
1182947599 22:34339076-34339098 ATGGATCTGGAAATGACGAGGGG - Intergenic
1183120974 22:35729809-35729831 AGGGCCCTGGAAATGGAGAATGG - Intergenic
1183579909 22:38717917-38717939 AGGAATCGAGAAATGGGGAAGGG - Intronic
1183991283 22:41598619-41598641 CTGGATCTGGAAGAGGAGAAAGG + Exonic
1184421921 22:44387117-44387139 ATGGATTTATACATGGAGATGGG + Intergenic
1185181407 22:49365591-49365613 ATGGATGTAGGGATGTAGAAGGG + Intergenic
949697997 3:6721344-6721366 ATTGATCAAGTAATGGAGAACGG + Intergenic
950711729 3:14817993-14818015 AAGGATCTAGAGAAGGGGAACGG - Intergenic
951300132 3:20986520-20986542 CTGGATCTGGAAAGGAAGAAAGG + Intergenic
951812325 3:26714549-26714571 AGAGCTCTGGAAATGGAGAAGGG - Intergenic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
952039295 3:29242020-29242042 ATGGATTTAGAGGTGAAGAATGG + Intergenic
952707932 3:36399110-36399132 TTGGCTCTAGAAATGGAAGAGGG + Intronic
952721711 3:36540585-36540607 ATGGATGTGAAGATGGAGAAAGG + Intronic
953534699 3:43768874-43768896 ATGAATTTGGATATGGAGAATGG + Intergenic
955176368 3:56618142-56618164 ATGGATAGATAAATGCAGAAAGG - Intronic
956045212 3:65188922-65188944 GTGTATCTAGAAAATGAGAAAGG + Intergenic
956744184 3:72298595-72298617 ATGGATTTATAAAAAGAGAAAGG + Intergenic
956809519 3:72850855-72850877 ATGGATGTAGAAATAGAAAAGGG - Intronic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957133305 3:76250729-76250751 ATAGTACTAAAAATGGAGAAAGG + Intronic
957791808 3:84951367-84951389 TTGGATAAAGAAATGGATAAAGG + Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958878079 3:99638325-99638347 AGGGAACTAGAAATAGTGAAAGG - Intergenic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
959741251 3:109722685-109722707 ATGAACCTAGAAATGAATAAGGG - Intergenic
959852866 3:111110977-111110999 ATGAATACAGAAATGCAGAAGGG - Intronic
960058898 3:113298392-113298414 TTGGATCTAGAGATGGAGAAAGG + Intronic
960194609 3:114749702-114749724 AAGCATGTGGAAATGGAGAAAGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960894475 3:122488142-122488164 ATGGATCTAGGAAGGGACCATGG + Intronic
961031547 3:123609331-123609353 ATGGATGCAGAAAGGGAGACAGG - Intergenic
961106838 3:124249778-124249800 TTGGATCTTGAAATGGAACAGGG - Intronic
961208403 3:125106129-125106151 ATGGGACTGGAAATAGAGAAGGG + Intronic
961573975 3:127820088-127820110 ATGGGTCTAGAAAAGGTTAAGGG - Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
963749081 3:149156390-149156412 CTGGGTCTTGAACTGGAGAAGGG - Intronic
965051926 3:163662443-163662465 ATGGCTCTGGAACTGGATAATGG + Intergenic
965386452 3:168051828-168051850 ACGGATGGAGACATGGAGAAGGG + Intronic
966508894 3:180738437-180738459 ATAGATCTATAAATGGAAAGAGG - Intronic
967443308 3:189534699-189534721 AGGGATCTAGTAATGGATTAGGG - Intergenic
967580997 3:191154012-191154034 ATGGAAATAGAAATAGAGAAGGG - Intergenic
968309252 3:197669283-197669305 TGGGATCCCGAAATGGAGAAAGG - Intergenic
969073291 4:4557122-4557144 GTGGACCAAGAAATGGAGGAAGG - Intergenic
970037838 4:11758795-11758817 AGGGAGATAGAAATGAAGAAAGG - Intergenic
970616187 4:17770356-17770378 GTGGAGGTGGAAATGGAGAATGG + Intronic
971352323 4:25864613-25864635 ATAGTTCTGGAAATGGAGGAGGG - Intronic
971916580 4:32877644-32877666 TTCGATATAGAAATGGAGAATGG + Intergenic
973302054 4:48597026-48597048 ATGGATCTGGCAGTGGAGACAGG - Intronic
973933392 4:55816883-55816905 TTGGATATGGAAATGGAGAAAGG - Intergenic
975443361 4:74437125-74437147 AGGGATCTGCAACTGGAGAATGG - Intergenic
976616205 4:87080148-87080170 ATGGCTCTAGATAGGCAGAAGGG + Intronic
976662991 4:87559808-87559830 ATTGATCTAGAAAGGGGTAATGG - Intergenic
977009082 4:91613001-91613023 ATGGAGCAAAAAATGGACAATGG + Intergenic
977113709 4:92994152-92994174 ATAGATGCAGAAATGGAGGAAGG + Intronic
978150892 4:105433450-105433472 ATGGCTCTGGAGATGGAAAATGG + Intronic
978278735 4:106984280-106984302 AAAGTTCTAGAAATGGAGAGTGG - Intronic
978646944 4:110945481-110945503 ATCGATCAAGAAGTGAAGAATGG - Intergenic
979263222 4:118671910-118671932 ATAGCTATAAAAATGGAGAAAGG + Intergenic
979264088 4:118681694-118681716 GTGGTTATAGAAATGAAGAATGG + Intergenic
979654709 4:123179029-123179051 ATATATCTAGGAATGGAAAATGG - Intronic
979741005 4:124150994-124151016 ATGGTCATATAAATGGAGAAAGG + Intergenic
980309728 4:131110859-131110881 ATGGATTTTTGAATGGAGAAAGG + Intergenic
980398080 4:132241804-132241826 ATAGAAGTAGAAGTGGAGAATGG + Intergenic
981451606 4:144904689-144904711 ATGTGTCTAGAACTGGATAAGGG - Intergenic
981655214 4:147105092-147105114 AGGGATCTGTAAAAGGAGAAGGG - Intergenic
982081910 4:151798506-151798528 ATGGTACTAGAAAGGGGGAAAGG + Intergenic
982352871 4:154434988-154435010 TGGGATCTCGCAATGGAGAAAGG + Intronic
983515530 4:168652264-168652286 AAGGATATAAAAATGGAGGAAGG + Intronic
983732697 4:171015675-171015697 ATGGACGAAGAAAGGGAGAAAGG + Intergenic
983904056 4:173167002-173167024 ATGGTTCCGGAAATGTAGAATGG - Intergenic
984744898 4:183205439-183205461 ACAGATCTCGAAATGTAGAAAGG - Intronic
984958592 4:185071493-185071515 ATGAATGTGGAAATGTAGAATGG + Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
988105202 5:26737162-26737184 CTGTATCTAGTAATGGAGAAGGG - Intergenic
989554276 5:42774112-42774134 ATGCATCTAAAATTGGAGACAGG + Intronic
991974936 5:72176341-72176363 GTGGATCAGGAAAAGGAGAAAGG + Intronic
992938841 5:81741388-81741410 AAAGTTCTAGAGATGGAGAACGG + Intronic
994305736 5:98201868-98201890 ATAGATCTAAAACTGTAGAAAGG - Intergenic
994748228 5:103705878-103705900 ATGATTAAAGAAATGGAGAAAGG + Intergenic
995282840 5:110355149-110355171 CTGGATCTGGAATGGGAGAAGGG - Intronic
995297694 5:110539663-110539685 AGGGATCTGCAATTGGAGAATGG + Intronic
995623510 5:114053695-114053717 GTTGATCAAGGAATGGAGAAGGG + Intergenic
995673248 5:114632179-114632201 AAAGATCTCAAAATGGAGAAAGG - Intergenic
995985313 5:118163892-118163914 ATTGATCCAGAAATGGAGTAGGG + Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996325597 5:122269238-122269260 ATGGATACAGAACTGCAGAATGG + Intergenic
996970854 5:129366342-129366364 ATAGATATGGATATGGAGAAAGG + Intergenic
997341239 5:133146667-133146689 AAGGATCTGGAAATGGACAGTGG - Intergenic
998536574 5:142937830-142937852 ACAGTTTTAGAAATGGAGAATGG + Intronic
1000022063 5:157326699-157326721 CTGGTTCTAGAAGGGGAGAATGG + Intronic
1000180748 5:158808447-158808469 ATGAGGCTAGAAAGGGAGAATGG - Intronic
1000217168 5:159171377-159171399 ATGTTTCTAAATATGGAGAAAGG - Intronic
1000962935 5:167621583-167621605 TTGGGTGTAGGAATGGAGAAAGG + Intronic
1002600512 5:180352022-180352044 GTGGCTCTACACATGGAGAATGG + Intronic
1002654876 5:180738021-180738043 ATAGATATAGAAAAGAAGAAGGG - Intergenic
1002717274 5:181235329-181235351 ATGGAGGTAGAAATTGAGGACGG - Exonic
1002873034 6:1184719-1184741 ATTAATCTAGAAAAGAAGAAAGG + Intergenic
1004557406 6:16712827-16712849 ATAAATCTATAAATGGCGAATGG - Intronic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1005163963 6:22897805-22897827 ATGGATCTTAAAATGGACAGGGG + Intergenic
1005925952 6:30445875-30445897 ATGGATTTACAAATGTAGGAAGG - Intergenic
1007227920 6:40327894-40327916 ATGGGGCCAGAAATGGGGAAGGG + Intergenic
1009855564 6:69258422-69258444 ATGTATATAGAAGTGAAGAACGG + Intronic
1009931087 6:70178524-70178546 AAGAATCTAGAAATAGACAATGG + Intronic
1010021542 6:71165374-71165396 ATTGATCAAGAAGTGAAGAATGG + Intergenic
1011063925 6:83303018-83303040 ATGGTTATAGAAATGGATCAAGG + Intronic
1012642832 6:101642387-101642409 ATGGAAAGAGAAATGGAGAATGG - Intronic
1016159473 6:140859880-140859902 CTGGATCTAGAAAGAGAGGAAGG - Intergenic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1018338586 6:162824182-162824204 ATGGATGTAGGAAGGGTGAATGG + Intronic
1019809362 7:3153157-3153179 CTTGATATAGAAATGCAGAAGGG - Intronic
1020245036 7:6423341-6423363 ATGGCGCTGGAAATGGAGAGAGG + Intronic
1020612649 7:10419661-10419683 ATGGATGTAGGAATTGAGAAAGG - Intergenic
1023266239 7:38409236-38409258 TTGGATCTAGAATTAGAGATGGG - Intronic
1023563346 7:41498560-41498582 AAGATTCTAGAAATGGGGAAAGG + Intergenic
1024518830 7:50285011-50285033 ATGGATGAAGAAATGATGAATGG + Intergenic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1026284885 7:68954582-68954604 AGGTAACTATAAATGGAGAAAGG + Intergenic
1026375932 7:69750944-69750966 ATGGAAGAAGAAAAGGAGAAGGG + Intronic
1027664611 7:81029650-81029672 AAGCAGCTGGAAATGGAGAAAGG - Intergenic
1027813077 7:82930827-82930849 ATGGGTCTAGAAAGGTAGGAAGG + Intronic
1027858786 7:83548147-83548169 ATAGATGTGAAAATGGAGAAAGG - Intronic
1028449553 7:90965882-90965904 AATGATCGAGAAGTGGAGAATGG - Intronic
1028962040 7:96760078-96760100 AAAGATATAGAACTGGAGAATGG - Intergenic
1031837571 7:126696672-126696694 AAGGAACTGGCAATGGAGAAGGG + Intronic
1033554417 7:142476262-142476284 CTGGATCTTGGAATGGACAAAGG - Intergenic
1033815064 7:145061068-145061090 GTTGATCTTGAAATGGAGAAGGG + Intergenic
1033857992 7:145588460-145588482 ATGGATCTAGATATAGAGGCTGG - Intergenic
1035332609 7:158106155-158106177 AAGGAACTGGAAATGGAGATGGG - Intronic
1035771170 8:2148099-2148121 ATGGGTCTAGGACTGGAGCAGGG - Intronic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036543425 8:9741901-9741923 TTGGAGTTAGAAAAGGAGAAGGG - Intronic
1036718062 8:11144982-11145004 AGGGATGGAGAAAGGGAGAAGGG + Intronic
1037298439 8:17426006-17426028 ATGGATCTATATATGGATATAGG - Intergenic
1040709913 8:50175681-50175703 ATACATGAAGAAATGGAGAAAGG + Intronic
1040987257 8:53309368-53309390 ATGGGTATGGATATGGAGAAAGG - Intergenic
1041063078 8:54055100-54055122 ATTGATCAAGAAGTGAAGAATGG - Exonic
1041152127 8:54945329-54945351 CTTGATGAAGAAATGGAGAAGGG - Intergenic
1041734175 8:61092618-61092640 CTGGCCCTGGAAATGGAGAAGGG - Intronic
1042054255 8:64746882-64746904 ATGGATTTATAAATGCAGATTGG - Intronic
1042830344 8:73019877-73019899 AAGGTTCTGGAAATGAAGAATGG - Intronic
1043277985 8:78424827-78424849 ATGGATCTAGAAATTGATAAAGG - Intergenic
1043397866 8:79856214-79856236 ATGGAGATAGAAGTGGGGAAGGG + Intergenic
1043592439 8:81846566-81846588 AGGGATCTGCAATTGGAGAATGG + Intergenic
1044612333 8:94105431-94105453 ATGGATTTGGCAGTGGAGAAAGG - Intergenic
1044645605 8:94439927-94439949 CTGGATCTAGAAAGGAAGGAAGG + Intronic
1045746119 8:105424344-105424366 TTGCATCTAGATATGAAGAATGG + Intronic
1045941193 8:107740071-107740093 ATCTATCTACAAAGGGAGAATGG + Intergenic
1046263215 8:111798256-111798278 AAGGGTCTAGAAATGGGAAATGG + Intergenic
1046314149 8:112478274-112478296 ATGGCTTTAGAAATGGGTAATGG + Intronic
1046338236 8:112818833-112818855 ATGGCTCTAGAAATGTTGAAAGG - Intronic
1047122389 8:121920268-121920290 GTGGAACTTGAAATGGAAAAAGG + Intergenic
1047552906 8:125895934-125895956 ATGGAGCTAGGAAGGGAGAAAGG - Intergenic
1047852221 8:128869537-128869559 ATGGATCAAGAAATAAAGCAAGG - Intergenic
1048600052 8:135910204-135910226 AAGGATCCAGAAATGAAGACAGG - Intergenic
1050267466 9:3906000-3906022 ATGGAGCAAGATATGGAGAAAGG + Intronic
1051209348 9:14725348-14725370 ATGGCTTTAGAATTGGTGAATGG - Intergenic
1051315555 9:15826792-15826814 ATGGATCAGGAAATAGAGCATGG - Intronic
1051937589 9:22462043-22462065 ATGGATCTGAGAAAGGAGAAGGG + Intergenic
1052430170 9:28356048-28356070 ATTGATCTAGAAATAGATTATGG + Intronic
1053241007 9:36495589-36495611 CTGGATCTGGAAATGAAGGAAGG - Intergenic
1053377418 9:37619428-37619450 ATTAATATAGAAATGGAGTAGGG + Intronic
1055075827 9:72214047-72214069 ATGGAGTTAGAGATGGAAAAAGG + Intronic
1055806581 9:80101984-80102006 TTGGATATAGAAATGTAAAATGG - Intergenic
1055960842 9:81818779-81818801 AGGAATCTAAAAATGGAGAAGGG - Intergenic
1058186697 9:101863784-101863806 CTGGCTCTTGAAAGGGAGAAAGG + Intergenic
1058764776 9:108171283-108171305 AAAGATCTAGAAATGGATATTGG + Intergenic
1059881265 9:118692183-118692205 ATGCATCTGGAAATGCATAAGGG + Intergenic
1059882150 9:118703408-118703430 ATGGTGGTAGAAGTGGAGAATGG - Intergenic
1060035548 9:120252489-120252511 ATGGAGCTTGCAATGCAGAAGGG + Intergenic
1061147768 9:128809644-128809666 ATGGGTATAGGAAGGGAGAAAGG + Exonic
1186070767 X:5817196-5817218 TTGGATCTAGTAAGGGAAAAGGG + Intergenic
1186892404 X:13971920-13971942 ATGGATATTGAGATTGAGAATGG - Intergenic
1187028265 X:15458212-15458234 TTGGATCTGGAAGGGGAGAATGG + Intronic
1187298682 X:18027287-18027309 AGGGATCTGGAAATAGAGACTGG - Intergenic
1187343729 X:18444224-18444246 ATGGTTCCATAAATGGAAAATGG - Intronic
1188330765 X:28868498-28868520 ATGGTTATAGAAATGGAGAAGGG - Intronic
1188675024 X:32929015-32929037 ATGGATTTCGGGATGGAGAAAGG + Intronic
1189144312 X:38640069-38640091 ATGGGTTTTGAAATGGAGCAAGG + Intronic
1190100453 X:47518734-47518756 AAGGATCAAGAAATGGAGATGGG - Intergenic
1193062240 X:77219582-77219604 ATGGAGTCAGAAATGGAGAATGG + Intergenic
1193136574 X:77978122-77978144 ATTGAAGTAGAAATGGACAATGG - Intronic
1193441648 X:81547591-81547613 ACTGATCTATCAATGGAGAAAGG + Intergenic
1194299014 X:92162606-92162628 CTGGATCTAGCCATGCAGAAGGG + Intronic
1195093925 X:101488427-101488449 GTGGACCTAGAAGTGGAGGAAGG - Exonic
1195599873 X:106734103-106734125 ATGTATCTAGAAATAGAAGATGG + Intronic
1195688332 X:107604459-107604481 ATGGCTCCAGAGAGGGAGAAAGG - Exonic
1196203338 X:112910892-112910914 ATAGACATAGAAATGGAGATAGG - Intergenic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1196630572 X:117934528-117934550 ATGGATAAAGAATTGGAGAATGG + Intronic
1198730471 X:139722508-139722530 AAGGATTTGGGAATGGAGAAAGG + Intergenic
1199995340 X:153021171-153021193 CTGAATCTGGAAATCGAGAAGGG + Intergenic
1200616617 Y:5387440-5387462 CTGGATCTAGCCATGCAGAAGGG + Intronic
1200803243 Y:7405901-7405923 ATGCATCTAGAGATGGATGAAGG + Intergenic
1202040607 Y:20679342-20679364 ATAGAACAAGAAATGGGGAAAGG + Intergenic