ID: 1016274381

View in Genome Browser
Species Human (GRCh38)
Location 6:142331473-142331495
Sequence CTGTATGACGAAAATGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016274381 Original CRISPR CTGTATGACGAAAATGCAGT GGG Intronic
907647429 1:56258317-56258339 GTGTATGACCAAAATGAAATGGG + Intergenic
909479635 1:76117544-76117566 CAGAATTATGAAAATGCAGTTGG - Intronic
910983973 1:92986512-92986534 ATGTATGAAGAAAATTCAGTGGG - Intergenic
915575250 1:156771548-156771570 CTGCCTGAGGCAAATGCAGTGGG - Intronic
915638266 1:157201391-157201413 CTGGATGACGCCAATGCAGTTGG - Intergenic
915888766 1:159751206-159751228 CTGTGTGAAGTCAATGCAGTGGG + Intergenic
917490060 1:175490990-175491012 CTGGATAAAGAAAATGTAGTAGG + Intronic
923518177 1:234715116-234715138 CTGTATTAGAAAAATGCACTGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1066209752 10:33225126-33225148 CTGTAGGAGGAAAATGCTATGGG - Intronic
1066419662 10:35252755-35252777 TTGGATGACAACAATGCAGTTGG - Intronic
1070149867 10:73799107-73799129 CTGTATGAGCAAACTGCAGGTGG + Exonic
1076944008 10:133631380-133631402 CTGTTTGACTAAAATGCAGCAGG + Intergenic
1077022989 11:427777-427799 CTTTATGCTGAAAATGCACTTGG - Intronic
1077999734 11:7484046-7484068 CTGTAAGGGGGAAATGCAGTGGG - Intergenic
1080588903 11:33704422-33704444 ATGAATGAGGAAAATGCAGCAGG + Intronic
1080739394 11:35049550-35049572 ATGTATGTCCAAAATCCAGTAGG - Intergenic
1085126178 11:74004209-74004231 CTGTTTGAGGAAACTGAAGTCGG + Intronic
1087161662 11:94954115-94954137 CTGTTTTGCGCAAATGCAGTTGG - Intergenic
1087676882 11:101173876-101173898 ATGTATGAAGAAAATGGAGGGGG + Intergenic
1098236724 12:68424751-68424773 CTGTGAGAGGGAAATGCAGTGGG - Intergenic
1098467114 12:70800237-70800259 CAGTATGTCTAAAATGCAGTGGG - Intronic
1101760842 12:107657602-107657624 CTGTATGACAAAAATGGTGAAGG + Exonic
1106355234 13:28975843-28975865 CTTTATAACGGAAATACAGTAGG - Intronic
1109913730 13:68952052-68952074 CTATATGTAAAAAATGCAGTTGG + Intergenic
1115373224 14:32643281-32643303 ATGTATGAAGAAAATGAAGAAGG - Intronic
1116024611 14:39499802-39499824 CTGCATGATGACAATCCAGTGGG + Intergenic
1117301832 14:54437836-54437858 CTTTATTACTAAAATGCATTGGG - Intronic
1119234021 14:73004683-73004705 TCACATGACGAAAATGCAGTCGG - Intronic
1120092189 14:80344866-80344888 CTGTAGGACAGAAATGTAGTTGG - Intronic
1124363835 15:29057585-29057607 CTGTATGACAAAAATACATCTGG - Intronic
1124786411 15:32685335-32685357 CTTGATGAGGGAAATGCAGTGGG + Intronic
1124966849 15:34438144-34438166 CTTTATGACACAAATCCAGTTGG + Intergenic
1127215438 15:56818558-56818580 CTGTATGACTATAAAGCAATGGG + Intronic
1130009061 15:80133759-80133781 CTGTTTTGCGCAAATGCAGTTGG + Intronic
1131280468 15:91017176-91017198 CAGTTTGAGGAAAATTCAGTGGG - Intronic
1131789691 15:95950645-95950667 CTGAATGACGAAGATTCAGTGGG - Intergenic
1133438557 16:5801130-5801152 ATGTGTGACAGAAATGCAGTGGG + Intergenic
1135468402 16:22707219-22707241 CTGGAAGAGGGAAATGCAGTAGG + Intergenic
1137933412 16:52610004-52610026 CTGTAGGACGAAAATAGAGTGGG + Intergenic
1138058332 16:53860057-53860079 TTGAATAAAGAAAATGCAGTAGG + Intronic
1153167625 18:2280375-2280397 CTTGATAATGAAAATGCAGTTGG - Intergenic
1153516259 18:5904890-5904912 TTGGATGAAGAAAATGCACTAGG - Intergenic
1154064842 18:11097112-11097134 CTGTTTGCCGAAAATGGAGCAGG - Intronic
1157966203 18:52211124-52211146 CTGGATGACAAAACTGCAGAGGG + Intergenic
1160472745 18:79152612-79152634 ATGAATGACGACAATTCAGTGGG + Intronic
1163230158 19:15996265-15996287 ATGTAAGTCCAAAATGCAGTAGG - Intergenic
1164633833 19:29778579-29778601 CTGGATGCCGCAAGTGCAGTGGG + Intergenic
1165979445 19:39707247-39707269 CAGGATGACCAAAGTGCAGTCGG - Exonic
924986116 2:271535-271557 GTGAATCACGAAAATGAAGTGGG - Intronic
925802558 2:7615469-7615491 CTGTGTGAGTAAAATGCACTAGG + Intergenic
926447310 2:12958845-12958867 CTGTAAGAAGAAAATGCTGTAGG - Intergenic
929559191 2:42945241-42945263 CTGTATGTCCAGAATGCGGTAGG - Intergenic
930266584 2:49207355-49207377 CTGTTTGGCGCAAATGCAGTAGG + Intergenic
935524501 2:104148933-104148955 CTGTTTGCCGAAAAAGCACTAGG + Intergenic
935962370 2:108438796-108438818 CTGCAGGAAGAAAATGGAGTCGG - Intergenic
936862918 2:117039275-117039297 TTGTATGAGAAAAATGAAGTGGG + Intergenic
936948777 2:117956107-117956129 CTGGATGAGGAAAATGAGGTAGG - Intronic
942510974 2:176700282-176700304 CAGTATGAAGTAAATGCATTTGG - Intergenic
943804468 2:192105778-192105800 CTTGATAAAGAAAATGCAGTTGG - Intronic
946597749 2:221325342-221325364 CTATATGAAGGAAATCCAGTTGG + Intergenic
1175352909 20:58338379-58338401 CTGTATGATGAACATGTAGAAGG + Intronic
1176207629 20:63898245-63898267 ATGAATGACTAAAATGCAGTGGG + Intronic
1176649028 21:9529131-9529153 CAGTGTGGAGAAAATGCAGTGGG - Intergenic
1182488546 22:30654458-30654480 CCCTATGACGAAAAAGCAGGTGG - Intronic
949161226 3:884650-884672 GTGTATAAAGAAAATGCACTGGG - Intergenic
951643007 3:24856829-24856851 CTGTATCTCGAAAAAGCAATTGG + Intergenic
951723090 3:25722734-25722756 CTGTAAGAGGAGCATGCAGTAGG - Intronic
957474581 3:80706606-80706628 CTGAATAAAGAAAATGCAGTGGG + Intergenic
957968260 3:87349348-87349370 CTGTACGAAAAAAATGTAGTTGG + Intergenic
964739218 3:159948040-159948062 CTGTATGACGAAAAAGGGGTGGG + Intergenic
965757149 3:172039207-172039229 TTGTATGAATAAAATGCTGTGGG + Intergenic
972957243 4:44407962-44407984 CTGGAAGATGAAAATGCAATAGG - Intronic
973571363 4:52242985-52243007 CTGGATGAAGCAAATGCTGTGGG + Intergenic
975396166 4:73875903-73875925 TTGTCTCCCGAAAATGCAGTGGG + Intergenic
976386388 4:84464210-84464232 CTGTAATACGAAAATGAAGGAGG + Intergenic
978820068 4:112956837-112956859 CTGAATGAAGAGAATGAAGTGGG + Intronic
979530415 4:121764545-121764567 GGGTATAACTAAAATGCAGTTGG + Intronic
981064395 4:140466851-140466873 ATGTATCACGAAAATGGGGTTGG + Intronic
981422378 4:144565824-144565846 CAGTGTGACAAAAATGCAATAGG + Intergenic
982175372 4:152701095-152701117 CGGTATGACGAAAATTTATTAGG + Intronic
985270919 4:188194347-188194369 CTGTAAGTCAAAAATGCATTAGG + Intergenic
985447362 4:190031837-190031859 CTGTTTGACTAAAATGCAGCAGG + Intergenic
990636029 5:57727589-57727611 CTCTATGAAAATAATGCAGTTGG + Intergenic
993268359 5:85760135-85760157 CTATATTAATAAAATGCAGTTGG + Intergenic
995835851 5:116398950-116398972 CTGAATGACCAAAATACATTTGG + Intronic
999103028 5:149043118-149043140 CTGTATTAGAAAAAGGCAGTTGG - Intronic
1001172345 5:169431890-169431912 CTGTATAATGGAAATGCTGTAGG + Intergenic
1003768176 6:9264803-9264825 CTTTGTGAGGAAAATACAGTTGG - Intergenic
1005281582 6:24280310-24280332 CTGTATGTTTAAATTGCAGTTGG - Intronic
1007047064 6:38786859-38786881 GTGTATGATAAAAATGAAGTTGG + Exonic
1007143079 6:39596210-39596232 ATGAATGGTGAAAATGCAGTGGG + Exonic
1010456326 6:76060151-76060173 CTGAATGAAGAAAATGAAGTCGG + Intronic
1010477533 6:76306747-76306769 CTGAATGAAGAAAATGATGTTGG + Intergenic
1012717969 6:102701263-102701285 CTGGATGAGGGGAATGCAGTGGG + Intergenic
1013339918 6:109203845-109203867 CTTTATGAAGGAAATCCAGTTGG - Intergenic
1013510795 6:110842697-110842719 CTTTATGATGAAAATTAAGTTGG + Intronic
1015812401 6:137173897-137173919 CTGGTTGAAGAAAATGCTGTTGG - Intergenic
1016274381 6:142331473-142331495 CTGTATGACGAAAATGCAGTGGG + Intronic
1021507349 7:21400366-21400388 CTCTTTGAAGAAAATGTAGTGGG + Intergenic
1022914245 7:34931274-34931296 CTGTATAAAGAAAACACAGTGGG - Exonic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1024019897 7:45359207-45359229 CTGTAAGACTAAAAGGCAGTAGG + Intergenic
1024154647 7:46608672-46608694 CTGAATGATCAAAATACAGTTGG - Intergenic
1024757966 7:52558658-52558680 CTGGAAGATGAAAATTCAGTTGG + Intergenic
1028238428 7:88389085-88389107 ATGTGTGAAAAAAATGCAGTGGG - Intergenic
1029696974 7:102220039-102220061 CTGTATGACCAAAATACAGGAGG + Intronic
1034907155 7:154959833-154959855 CTGTATTATTAAGATGCAGTAGG - Intronic
1036305215 8:7596365-7596387 TTGTATGAAGGAACTGCAGTGGG - Intergenic
1036356065 8:8044361-8044383 TTGTATGAAGGAACTGCAGTGGG - Intergenic
1037688915 8:21166560-21166582 GTGTATCAAGAAAGTGCAGTGGG - Intergenic
1045628665 8:104088289-104088311 CAGGATGACGAAAATGCACATGG + Intronic
1047710579 8:127548016-127548038 CTGTAGGAGGAAAATTCAGCAGG + Intergenic
1049851537 8:144834211-144834233 CTGTAGTACAAAAATGCTGTTGG + Intronic
1055266636 9:74500524-74500546 GTGGATGAGGGAAATGCAGTGGG - Intronic
1203494007 Un_GL000224v1:133644-133666 CTATGTGAGGAAAATGCATTTGG - Intergenic
1203506627 Un_KI270741v1:75519-75541 CTATGTGAGGAAAATGCATTTGG - Intergenic
1203626764 Un_KI270750v1:32680-32702 CAGTGTGGAGAAAATGCAGTGGG - Intergenic
1187655329 X:21464956-21464978 CTATGTGGGGAAAATGCAGTGGG - Intronic
1188435123 X:30150328-30150350 CTGGACGACGGGAATGCAGTGGG - Intergenic
1189501111 X:41560048-41560070 CTGTATGAGCAAAAGGCAATTGG - Intronic
1191571929 X:62637308-62637330 CTTTTTGAAGAAAATGCAGGTGG + Intergenic
1191572090 X:62640190-62640212 CTTTTTGAAGAAAATGCAGATGG + Intergenic
1195405044 X:104503416-104503438 CTTTGTGAAGAAAATGCATTTGG - Intergenic
1196948717 X:120854296-120854318 GTGTATGAGGAAACTCCAGTTGG + Intergenic