ID: 1016275655

View in Genome Browser
Species Human (GRCh38)
Location 6:142349384-142349406
Sequence GGGGCATTCCAGCTACATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016275655_1016275660 -4 Left 1016275655 6:142349384-142349406 CCCCCATGTAGCTGGAATGCCCC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1016275660 6:142349403-142349425 CCCCACATAGTTGCTTAGACTGG No data
1016275655_1016275665 5 Left 1016275655 6:142349384-142349406 CCCCCATGTAGCTGGAATGCCCC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1016275665 6:142349412-142349434 GTTGCTTAGACTGGCACAAGGGG No data
1016275655_1016275664 4 Left 1016275655 6:142349384-142349406 CCCCCATGTAGCTGGAATGCCCC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1016275664 6:142349411-142349433 AGTTGCTTAGACTGGCACAAGGG No data
1016275655_1016275663 3 Left 1016275655 6:142349384-142349406 CCCCCATGTAGCTGGAATGCCCC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1016275663 6:142349410-142349432 TAGTTGCTTAGACTGGCACAAGG 0: 1
1: 0
2: 2
3: 9
4: 88
1016275655_1016275666 10 Left 1016275655 6:142349384-142349406 CCCCCATGTAGCTGGAATGCCCC 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1016275666 6:142349417-142349439 TTAGACTGGCACAAGGGGACTGG 0: 1
1: 0
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016275655 Original CRISPR GGGGCATTCCAGCTACATGG GGG (reversed) Intronic
901179805 1:7333853-7333875 TGGGCATTCCAGTGAAATGGAGG + Intronic
905428276 1:37901703-37901725 GGGGATTTCCAGCCACAGGGCGG + Intronic
906333496 1:44907766-44907788 GGTGCATGCCAGCTACTCGGTGG + Intronic
911360749 1:96873317-96873339 GGGACATTGCAGCTATATGTTGG + Intergenic
918410691 1:184255132-184255154 GGGGAATTCCAGCTATTTTGGGG + Intergenic
918684405 1:187397107-187397129 GGGACACTCCAGCTTGATGGGGG + Intergenic
921585387 1:216940502-216940524 GGGGCATTCCAGCCTCCTGTTGG - Intronic
922534434 1:226369368-226369390 GGAGCCTTCCAGCTACATCCTGG - Intronic
1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG + Intronic
1064208087 10:13341834-13341856 CTGTCATTCCAGCTACTTGGAGG + Intronic
1067554915 10:47262081-47262103 GGGGCATACCTGCAACATGCTGG + Intergenic
1067561470 10:47307644-47307666 GAGGCATTCAAGCCACATGGAGG + Intronic
1067562733 10:47315200-47315222 GAGGCATTCCAGGTATTTGGGGG - Intergenic
1068521059 10:58077970-58077992 TGGGAATTCAAGCTACATGAAGG - Intergenic
1070473943 10:76813847-76813869 TGGACATTCCACCTACATGCTGG + Intergenic
1070652669 10:78249339-78249361 GTGACATTACAGCTACATGACGG - Intergenic
1071012654 10:80955899-80955921 GAGGCAGTCCAGCTACAGGAAGG - Intergenic
1073048466 10:100653648-100653670 GGGGAAGGGCAGCTACATGGAGG - Intergenic
1074511317 10:114115059-114115081 GGGGCTTTACAACTTCATGGTGG + Intergenic
1074816777 10:117148023-117148045 GGGGAATACCTGGTACATGGTGG + Intergenic
1076168172 10:128299080-128299102 GAGGGAATCCAGCTTCATGGAGG - Intergenic
1077017602 11:403852-403874 GGGCCAGTCCAGCTCCCTGGGGG + Intronic
1077343879 11:2037613-2037635 GGGGGATTCCAGGGACATTGAGG + Intergenic
1079898272 11:26149327-26149349 GGAGCCTTCCAGCTACACTGAGG + Intergenic
1082040749 11:47682856-47682878 AGGGCATTTCTGCTTCATGGAGG + Intronic
1084725770 11:70940789-70940811 GGGGCATTAAAACTTCATGGAGG + Intronic
1087877172 11:103372159-103372181 GGTGCATCCCAGCTACTCGGAGG - Intronic
1202826865 11_KI270721v1_random:92802-92824 GGGGGATTCCAGGGACATTGAGG + Intergenic
1095493530 12:42760936-42760958 AGTGCAGTCCAGCTACTTGGTGG + Intergenic
1096384917 12:51188925-51188947 GGGGCTTTCCAGCCACAGTGAGG + Exonic
1098044091 12:66382105-66382127 GGCGCATGCCAGCTACTTGGGGG + Intronic
1103403047 12:120656104-120656126 GGAACAGACCAGCTACATGGTGG + Intronic
1105255701 13:18743001-18743023 GGGGCAATCCAGAGCCATGGGGG - Intergenic
1106432637 13:29695442-29695464 GCGGAGTTCAAGCTACATGGTGG + Intergenic
1106484417 13:30159697-30159719 GGGTGACTCCAGCCACATGGGGG - Intergenic
1109624566 13:64958248-64958270 GGGGCATAGCTGCTACCTGGAGG - Intergenic
1112362537 13:98730536-98730558 GGGACCTGCCAGCTGCATGGCGG + Intronic
1112688568 13:101862155-101862177 GGTGGATTCCAGGAACATGGTGG + Intronic
1115710444 14:36044832-36044854 GGGGGATTCCAGCTAGAAAGAGG - Intergenic
1117333403 14:54736401-54736423 GGGGCACTGCAGCTACCTGTCGG - Intronic
1122480883 14:102046570-102046592 GGGTAATCCCAGCCACATGGTGG + Intronic
1126602035 15:50438461-50438483 CTGGAATTCCAGCTACTTGGAGG + Intronic
1131440523 15:92456173-92456195 GGGTTTTTCCTGCTACATGGCGG - Intronic
1136453639 16:30368861-30368883 GGGGAACTCCAGCTACAGGCCGG - Intronic
1141759639 16:86019484-86019506 GGGGCATTCTGGGTCCATGGGGG + Intergenic
1142282021 16:89153726-89153748 GGGGCCTTCCAGCTCCAGTGCGG + Intronic
1143219452 17:5249157-5249179 AGGGAATTCCAGCTGCGTGGGGG + Intergenic
1147238861 17:39077361-39077383 GGGGCTTCCCTGCTACCTGGAGG - Intronic
1147497963 17:40936295-40936317 GCGGCTTTCCAGCTTCATGTTGG + Exonic
1147910650 17:43853972-43853994 GGTGGAGTCCAGCTGCATGGGGG - Exonic
1148030106 17:44613811-44613833 GTGGTGTCCCAGCTACATGGTGG + Intergenic
1148097202 17:45060832-45060854 GGGGCATTCCGGCTCCAGGCAGG + Intronic
1151250444 17:72829863-72829885 GGGGCATTTCAGCTGAGTGGGGG - Intronic
1152927098 17:83092351-83092373 TGGCCCTTCCAGCCACATGGGGG + Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1159581330 18:70237010-70237032 GGGACATTCTAGCTAGGTGGGGG + Intergenic
1165734225 19:38165585-38165607 GGGCCATCCCAGCTACAAGGAGG + Intronic
1167692925 19:50997981-50998003 GGAGTTTTCCAGCTGCATGGGGG + Intronic
1168670456 19:58237581-58237603 GGGCCCTTCCAGCTACAGGTAGG + Intronic
928401665 2:30983273-30983295 GGGGCATTCAAGTTCCATGAGGG + Intronic
931482681 2:62657827-62657849 GGGGCCTTCCAGGTTCAAGGGGG - Intergenic
944252243 2:197590028-197590050 GGGTAATCCCAGCTACTTGGGGG - Intronic
948781000 2:240321730-240321752 GAGGCATCCCTGCTTCATGGTGG - Intergenic
1169090454 20:2858215-2858237 GTAGCATGCCAGCTACTTGGGGG - Intronic
1172328296 20:34054701-34054723 CTGGCATCCCAGCTACTTGGGGG + Intronic
1175785930 20:61711850-61711872 GTGGTATTCCAGCTGCAGGGAGG + Intronic
1176841720 21:13848031-13848053 GGGGCAATCCAGAGCCATGGGGG - Intergenic
1181064060 22:20297388-20297410 CTGGCACTTCAGCTACATGGTGG - Intergenic
1181450008 22:23013508-23013530 GGGGCCTTCCAGCAACACTGAGG + Intergenic
1183020831 22:35024540-35024562 GGGGCATTCCAGCCCCAGTGGGG + Intergenic
952514397 3:34089888-34089910 GGCGGATTCCAGCTGCATGCTGG + Intergenic
954925688 3:54232258-54232280 GGGGGTTTTCAGCTACAGGGAGG + Intronic
960959345 3:123058350-123058372 GGGGGACTCCAGCCACATGAGGG + Intergenic
965422490 3:168479182-168479204 GCGTGATTCCAGCTACTTGGGGG + Intergenic
965789896 3:172375858-172375880 GGGGAATTGCAGCTCCAAGGTGG + Intronic
968756243 4:2417865-2417887 GGGGCATTCCTGGTGCAGGGAGG + Intronic
974140756 4:57883495-57883517 GCATCATGCCAGCTACATGGTGG + Intergenic
974514873 4:62896814-62896836 TGGGGATGCCAGCTGCATGGGGG + Intergenic
976776946 4:88717572-88717594 TGGGAATTCCAATTACATGGAGG + Intergenic
987309374 5:16667642-16667664 AGGGCGTTCCAGCTGCTTGGAGG - Intronic
988604683 5:32669099-32669121 GGGGCTTTCCAGCAACACAGAGG + Intergenic
991236712 5:64407268-64407290 GGGACATTCCAGCTTGGTGGGGG + Intergenic
994267807 5:97738696-97738718 GGTGCACTCCATCTGCATGGAGG + Intergenic
999380152 5:151115745-151115767 ATGGCATTTCAGCTACATTGTGG - Intronic
1000275549 5:159731631-159731653 TGAGCATTGCAGCTACATGAGGG - Intergenic
1001788517 5:174434803-174434825 GGAGCATTCCCTCTTCATGGGGG - Intergenic
1003396152 6:5753825-5753847 GTGGCAGTCCAGCACCATGGTGG + Intronic
1004968638 6:20883244-20883266 GGGGAATTCAAGCTCCATGCTGG + Intronic
1006589572 6:35144297-35144319 GGGGCATTCCTGCTAAATAATGG - Intronic
1008036173 6:46747525-46747547 TGGGCATTCCACATACATGGAGG + Intronic
1012083070 6:94785287-94785309 GGGGCACTCCAGCTTGGTGGAGG - Intergenic
1012263115 6:97111086-97111108 GGGGCCTTCCAGCAACACTGAGG + Intronic
1016275655 6:142349384-142349406 GGGGCATTCCAGCTACATGGGGG - Intronic
1017860847 6:158395629-158395651 AGGGCCAGCCAGCTACATGGAGG - Intronic
1027266723 7:76498692-76498714 AGGGCATTCCAGCCACACGGAGG + Intronic
1027318103 7:76996809-76996831 AGGGCATTCCAGCCACACGGAGG + Intergenic
1028896629 7:96048647-96048669 GGGGCAGTTCAGTTACATTGAGG + Intronic
1031038385 7:116813338-116813360 GGGCAATCCCAGCTACTTGGAGG - Intronic
1033062766 7:138123863-138123885 GGGGCATCCCAGATCCATGTTGG + Intergenic
1035348878 7:158228991-158229013 GGAGCATTCCTGCTACAGGGTGG - Intronic
1037523480 8:19702638-19702660 GGAGCATTCCAGGTGCATGCAGG - Intronic
1037937815 8:22927228-22927250 GGGGCATTCAGGCTGCAGGGAGG + Intronic
1039976460 8:42370589-42370611 TGTGCATACCAGCAACATGGGGG + Intronic
1041536648 8:58933749-58933771 GGGGCTTTCCATCTTCTTGGGGG + Intronic
1047069252 8:121324330-121324352 GTGGCATTCCAACTGCAAGGAGG - Intergenic
1047126556 8:121968638-121968660 GTGCCATTCCAAATACATGGTGG + Intergenic
1047218173 8:122896080-122896102 GAGGCATTCCAGCTTCAGGCAGG - Intronic
1047530349 8:125668473-125668495 GAGGCAATTCAGCTTCATGGGGG - Intergenic
1047740771 8:127804660-127804682 GTGGCATCCCAGCTACTCGGAGG - Intergenic
1049453688 8:142676346-142676368 GGGGCATACCAGGCACATGGTGG + Intronic
1052881411 9:33602956-33602978 GGGGCAATCCAGAGCCATGGGGG + Intergenic
1052908470 9:33858535-33858557 GGTGCATCCCAGCTACTTAGTGG - Intronic
1053494907 9:38542889-38542911 GGGGCAATCCAGAGCCATGGGGG - Exonic
1057624091 9:96662073-96662095 GGGTGATTCCAGCTACCTGGTGG - Intergenic
1060621492 9:125071103-125071125 GAGGCCTCCTAGCTACATGGAGG + Intronic
1195039237 X:100999096-100999118 GGGACATTCATGATACATGGAGG - Intergenic
1196243793 X:113374413-113374435 GGGGAATCCCAGCTACTGGGAGG - Intergenic
1198531378 X:137551732-137551754 GAGGCACCCCAGCCACATGGTGG - Intergenic
1201968138 Y:19761099-19761121 TGGCCTCTCCAGCTACATGGGGG + Intergenic