ID: 1016276083

View in Genome Browser
Species Human (GRCh38)
Location 6:142354287-142354309
Sequence GAGAATCACTTGAACGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016276078_1016276083 11 Left 1016276078 6:142354253-142354275 CCTGTAATCCCGGCTACTCAGGA 0: 380
1: 55262
2: 143239
3: 230404
4: 202233
Right 1016276083 6:142354287-142354309 GAGAATCACTTGAACGAACTTGG No data
1016276082_1016276083 2 Left 1016276082 6:142354262-142354284 CCGGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1016276083 6:142354287-142354309 GAGAATCACTTGAACGAACTTGG No data
1016276080_1016276083 3 Left 1016276080 6:142354261-142354283 CCCGGCTACTCAGGAGGCTGAGG 0: 1159
1: 100407
2: 205957
3: 239744
4: 153584
Right 1016276083 6:142354287-142354309 GAGAATCACTTGAACGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016276083 Original CRISPR GAGAATCACTTGAACGAACT TGG Intronic
No off target data available for this crispr