ID: 1016280650

View in Genome Browser
Species Human (GRCh38)
Location 6:142414464-142414486
Sequence TCCGCACCACCCTTAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016280648_1016280650 -8 Left 1016280648 6:142414449-142414471 CCAGGGTTAGGAGCCTCCGCACC 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1016280650 6:142414464-142414486 TCCGCACCACCCTTAGAGCCTGG No data
1016280646_1016280650 8 Left 1016280646 6:142414433-142414455 CCAAGCATTGAAATAACCAGGGT 0: 1
1: 0
2: 1
3: 3
4: 99
Right 1016280650 6:142414464-142414486 TCCGCACCACCCTTAGAGCCTGG No data
1016280641_1016280650 23 Left 1016280641 6:142414418-142414440 CCCACCTCATACATACCAAGCAT 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1016280650 6:142414464-142414486 TCCGCACCACCCTTAGAGCCTGG No data
1016280643_1016280650 19 Left 1016280643 6:142414422-142414444 CCTCATACATACCAAGCATTGAA 0: 1
1: 0
2: 2
3: 14
4: 210
Right 1016280650 6:142414464-142414486 TCCGCACCACCCTTAGAGCCTGG No data
1016280642_1016280650 22 Left 1016280642 6:142414419-142414441 CCACCTCATACATACCAAGCATT 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1016280650 6:142414464-142414486 TCCGCACCACCCTTAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016280650 Original CRISPR TCCGCACCACCCTTAGAGCC TGG Intronic
No off target data available for this crispr