ID: 1016281874

View in Genome Browser
Species Human (GRCh38)
Location 6:142427599-142427621
Sequence TTTCAGCAGCACCATACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 18, 3: 77, 4: 336}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016281869_1016281874 7 Left 1016281869 6:142427569-142427591 CCCAAGTTGCTTCCACATATTTG 0: 2
1: 334
2: 712
3: 1570
4: 2391
Right 1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG 0: 1
1: 0
2: 18
3: 77
4: 336
1016281867_1016281874 14 Left 1016281867 6:142427562-142427584 CCCAGTTCCCAAGTTGCTTCCAC 0: 8
1: 812
2: 1555
3: 2121
4: 1803
Right 1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG 0: 1
1: 0
2: 18
3: 77
4: 336
1016281870_1016281874 6 Left 1016281870 6:142427570-142427592 CCAAGTTGCTTCCACATATTTGG 0: 1
1: 2
2: 10
3: 34
4: 184
Right 1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG 0: 1
1: 0
2: 18
3: 77
4: 336
1016281873_1016281874 -5 Left 1016281873 6:142427581-142427603 CCACATATTTGGGTATCTTTTCA 0: 5
1: 391
2: 703
3: 1100
4: 1500
Right 1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG 0: 1
1: 0
2: 18
3: 77
4: 336
1016281866_1016281874 27 Left 1016281866 6:142427549-142427571 CCTCTGTCTGTTACCCAGTTCCC 0: 4
1: 100
2: 1519
3: 1816
4: 1677
Right 1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG 0: 1
1: 0
2: 18
3: 77
4: 336
1016281868_1016281874 13 Left 1016281868 6:142427563-142427585 CCAGTTCCCAAGTTGCTTCCACA 0: 7
1: 823
2: 1583
3: 2112
4: 1884
Right 1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG 0: 1
1: 0
2: 18
3: 77
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016281874 Original CRISPR TTTCAGCAGCACCATACTTC TGG Intronic
901071773 1:6523647-6523669 CTGCAGCAGCACCATTCTCCAGG - Exonic
901302859 1:8212076-8212098 TTTCAGCTGCGGCATATTTCTGG + Intergenic
905528645 1:38659076-38659098 TAACAGCAGCACCCCACTTCTGG + Intergenic
905829476 1:41053685-41053707 TTACTGCAGCACCCTATTTCTGG - Intronic
906655026 1:47541897-47541919 TTTCAGCAGCACCCCACTTCTGG - Intergenic
906872734 1:49502414-49502436 TTACAGCAGCACCCCACTTCTGG - Intronic
907616872 1:55934942-55934964 TTTCAGCAACACCCTAATCCTGG + Intergenic
907831741 1:58070826-58070848 TTGCAGCAGCTCCATTCATCCGG - Intronic
907989570 1:59566183-59566205 TTTCATCCACACCAAACTTCTGG - Intronic
909396269 1:75174195-75174217 TTTCAGTAACACCATTCTTTTGG - Intergenic
909751288 1:79164942-79164964 TTACAGCAGCACCTCACTCCTGG - Intergenic
909752479 1:79179751-79179773 TTTCAGGAGAACCCTACTCCTGG + Intergenic
910001862 1:82351105-82351127 TTACAGCAGCACCCTACTCCTGG + Intergenic
910010198 1:82452287-82452309 TTACAGTAGCACCCCACTTCTGG + Intergenic
910057756 1:83051893-83051915 TTTCAGCAACACCTCACTCCTGG + Intergenic
911098474 1:94075431-94075453 TGACAGCAGCACCAAACTGCAGG - Intronic
911331316 1:96528865-96528887 TTTCAGCTGCACCCCACTCCTGG - Intergenic
911985573 1:104617639-104617661 TTTTAGCAACACCCTACTCCTGG + Intergenic
912182592 1:107236948-107236970 TTTCAGCAACACCCCACTTCTGG - Intronic
912635121 1:111284757-111284779 CTTCAGTAGCTCCATTCTTCAGG - Intergenic
915858512 1:159417684-159417706 ATACAGCAGCACCCTACTCCTGG - Intergenic
916048981 1:161021592-161021614 TTTCTGCAGGACCAAACTGCAGG - Intronic
917547207 1:175983564-175983586 TTTCAGCAGCACCCCACTTCTGG - Intronic
918592010 1:186250540-186250562 TTTCAGCAGCAACACACTCCTGG + Intergenic
918727671 1:187946853-187946875 TTTCAGCAGCATCCCACTCCTGG - Intergenic
918931518 1:190861365-190861387 TTTCAGGAGCACCCCACTTGTGG + Intergenic
919129342 1:193433778-193433800 TCTCAGCAGTACCCCACTTCTGG + Intergenic
921386603 1:214576382-214576404 TTTCAGCAACACCCCACTCCTGG - Intergenic
921567600 1:216738924-216738946 TTTCTGCAGCTTCAAACTTCTGG + Intronic
921594481 1:217039285-217039307 TTTCAGCAACACCCCACTCCTGG + Intronic
921610287 1:217205775-217205797 TTTCAGCAGCACCCAACTCCTGG - Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922610348 1:226922259-226922281 TTACAGCAGCACCCCACTACTGG - Intronic
922667936 1:227488693-227488715 TTACAGCAGCACCCTACTCCTGG + Intergenic
923687264 1:236161926-236161948 TTTCAGCAACACCCCACTCCTGG - Intronic
923949507 1:238932310-238932332 TTTCAGCAGCACCATGCCCAAGG - Intergenic
924495371 1:244583714-244583736 TACCAGCAGCACCATCCTCCAGG + Intronic
1062859147 10:796414-796436 TTACAGCAGCACCCCACTTCCGG - Intergenic
1063626332 10:7693193-7693215 TTTCAGCAGCATACCACTTCTGG + Intergenic
1068011398 10:51455940-51455962 TTACAGCAGCACCCAACTCCTGG + Intronic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070384968 10:75916245-75916267 TTGCAGGAGCAGCATCCTTCAGG - Intronic
1070519650 10:77241184-77241206 TTCCAACAGCCCCATCCTTCTGG - Intronic
1070971215 10:80569033-80569055 TTTCAGCAGCACCCTGCTTCTGG + Intronic
1071728748 10:88226518-88226540 ATTTAGCAGCACCATCCTACAGG + Intergenic
1071990685 10:91098203-91098225 TTACAGCAGCACCCCACTCCTGG + Intergenic
1072023141 10:91425343-91425365 TTTCAGCAGCTTCTTTCTTCGGG - Exonic
1074069030 10:110048343-110048365 TTACAGCAGCACCCCACTCCTGG - Intronic
1074673118 10:115818253-115818275 GCTCAGCAGCTCCATGCTTCTGG - Intronic
1074965725 10:118489305-118489327 TTTCTGTAGCACCCTGCTTCTGG - Intergenic
1075354381 10:121757424-121757446 TTTCAGCAGTACCCCACTCCTGG + Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077838673 11:5948105-5948127 CTTCTTCAGCACCATCCTTCTGG + Exonic
1077846135 11:6026915-6026937 TTTCTTCAGCACCATACTGCTGG - Exonic
1078117508 11:8467982-8468004 TTTTGGCAGCACCCCACTTCTGG + Intronic
1078510204 11:11979297-11979319 TTTCAGCTGCTCCAAACTCCAGG + Intronic
1079147720 11:17868597-17868619 TTTCAGCAGCACCCTACTCCTGG + Intronic
1079559538 11:21804719-21804741 TTTCAGCAACACCCCACTCCTGG + Intergenic
1079826865 11:25206972-25206994 TTTCAGCAACACCCCACTCCTGG - Intergenic
1080129890 11:28781683-28781705 TATCAGCAGCACCCCATTTCTGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080717698 11:34819771-34819793 TTTCAGCAGTACCCTACTCTTGG + Intergenic
1081083950 11:38775881-38775903 TTTTAGCAGCACCTTACTTCTGG + Intergenic
1081175303 11:39921016-39921038 TTTCAGCAACATCCCACTTCTGG - Intergenic
1082742422 11:56925578-56925600 TTTCAGCAACATCCCACTTCTGG + Intergenic
1082748562 11:56994708-56994730 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1083121979 11:60521785-60521807 TTTCAGCAGCACCCCACTCCTGG + Intronic
1083919663 11:65775515-65775537 CTGCAGCAGCACCACGCTTCTGG + Intergenic
1085457763 11:76674823-76674845 TTTCTGCAGCACCAGGCTGCTGG + Intergenic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1086668134 11:89510733-89510755 TTTTAGCAGCAACATGCTTCTGG + Intergenic
1086807516 11:91263409-91263431 ATTGAGCATCACCATAATTCAGG + Intergenic
1086992101 11:93314589-93314611 TTACAGCAGCACCCCACTCCTGG + Intergenic
1087145338 11:94805243-94805265 TTTCAACAGGACCAGAATTCTGG + Intronic
1087908378 11:103725343-103725365 TTACAGCAGAACCCTACTTCTGG + Intergenic
1089285627 11:117406080-117406102 TTTCAGCAACACCCCACTCCTGG + Intronic
1089809830 11:121122507-121122529 TTACAGCAGCACCCCACTCCTGG - Intronic
1091065597 11:132508871-132508893 TTTCAGCAGCATCCCACTTCTGG - Intronic
1091104140 11:132902608-132902630 ATGCAGAAGCACCAGACTTCTGG - Intronic
1092652115 12:10646110-10646132 TTTCAGTAGCACCCTACTCCTGG - Intronic
1092662774 12:10756382-10756404 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096868248 12:54577886-54577908 TGTCATCAGCACCATCCATCAGG + Exonic
1096960360 12:55570863-55570885 TTTCAGCAGCACCCCACTTCTGG + Intergenic
1097441434 12:59613009-59613031 TTACAGCAGCACCCCACTCCTGG + Intronic
1097901222 12:64875488-64875510 TTTCAGCTGCAGCATCCCTCTGG - Exonic
1098078687 12:66760305-66760327 TTTCAGCAACCCCCTACTCCTGG + Intronic
1098650027 12:72953041-72953063 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1098845314 12:75527964-75527986 TTCCAGAAGCAACAAACTTCTGG - Intergenic
1099164838 12:79292010-79292032 TTTCAGCATCATCATCCTTGAGG - Exonic
1099668268 12:85658695-85658717 TTTCAGCAGTACCCAACTCCTGG - Intergenic
1099678858 12:85797850-85797872 TTTCTGAAGCACCATACCTATGG + Intergenic
1099957122 12:89361743-89361765 TTCCAGGTGCACCATACTCCAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1104830120 12:131744689-131744711 TTTCAGCAGTACCCCAATTCTGG + Intronic
1106614612 13:31315151-31315173 TTTCAGCAACACCCCACTCCTGG - Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1108043685 13:46362711-46362733 ATTCAGCATCTCCATGCTTCAGG + Intronic
1108184433 13:47874186-47874208 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1108344618 13:49532987-49533009 TTTCAGGAACACCATAATTTTGG + Exonic
1108581535 13:51832449-51832471 TCTCTGCAACACCATCCTTCGGG + Intergenic
1109169370 13:59076569-59076591 TTTCAGCAGCACCCTACTCCTGG + Intergenic
1109890244 13:68602325-68602347 TTACAGCAATACCACACTTCTGG - Intergenic
1111046727 13:82823501-82823523 TGTCAGCAGCACCAGACTAAGGG + Intergenic
1111674316 13:91368189-91368211 TTACAGCAGCACCTCATTTCAGG - Intergenic
1112582594 13:100689358-100689380 TTACAGCAGCACCCCACTTCTGG - Intergenic
1112799430 13:103093820-103093842 TTTCAGCAACACCCCACTCCTGG + Intergenic
1112861359 13:103832184-103832206 TTTCAACAACACCTCACTTCTGG + Intergenic
1113229783 13:108199922-108199944 GTTAAGTAGCACCCTACTTCTGG + Intergenic
1114347981 14:21817210-21817232 TTTCAGCAACACCTCACTCCTGG + Intergenic
1115234038 14:31191045-31191067 TTTCAGGAGCTCCAAACTCCTGG + Intronic
1115527802 14:34299132-34299154 TTTCTCCAGCACTTTACTTCAGG - Intronic
1115893911 14:38062405-38062427 TTTCAGTAGCACCCCACTCCTGG + Intergenic
1116133669 14:40892412-40892434 TTTCAGCAACACCCTACTCCTGG + Intergenic
1116387293 14:44347498-44347520 TTTAAGCAGCACCCCACTCCTGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1116776856 14:49191016-49191038 TTTCTCCAGCACCCTACCTCTGG - Intergenic
1117256669 14:53985153-53985175 TTTCAGCAACACCCCACTCCTGG - Intergenic
1121000259 14:90446831-90446853 TTATGGCAGCACCACACTTCTGG - Intergenic
1121063549 14:90939420-90939442 TTTCAGCAGCACCCCACTCGTGG + Intronic
1121166409 14:91806277-91806299 TTACAGCAGCACCCCACTCCTGG - Intronic
1127539233 15:59920741-59920763 TTTGAGCAGCAAGATACTACAGG - Intergenic
1127749962 15:62027191-62027213 TTTCAGAAGCACCAACATTCTGG + Intronic
1128688949 15:69708613-69708635 TTTCAGCAACACCCCACTCCTGG + Intergenic
1128985204 15:72215369-72215391 TTTCAGCCTTACCATACGTCAGG - Intronic
1129964556 15:79722427-79722449 TTTTGGCAGCACCTCACTTCTGG - Intergenic
1130233237 15:82112680-82112702 ATTCAGCAGATACATACTTCGGG - Intergenic
1131768036 15:95701525-95701547 TTTCAGCAACACCCCACTTCTGG + Intergenic
1131867582 15:96728477-96728499 TGTCAGCAGTACCCTACTCCAGG + Intergenic
1132037792 15:98501256-98501278 TTGAAGCAGCACCCTACATCAGG - Intronic
1132506546 16:312615-312637 TTTTAGCAGCACCTGACTTGAGG - Intronic
1133375346 16:5282353-5282375 TTTTAGCAACACCCCACTTCTGG - Intergenic
1134647338 16:15880252-15880274 TTCCAGCTGCCCCACACTTCAGG - Intronic
1136182993 16:28567493-28567515 TTATAGCAGCACCCCACTTCTGG - Intronic
1138425534 16:56929713-56929735 TGACATAAGCACCATACTTCGGG - Intergenic
1139796235 16:69485226-69485248 TTTTAGCAGCACCAAAGTTAGGG + Intergenic
1139812885 16:69637382-69637404 TTTCAGCAACACCCCACTCCTGG + Intronic
1141568065 16:84916717-84916739 TTTCAGCAGCTCCAGGCTGCAGG + Intronic
1143213345 17:5205676-5205698 ATTCAGCAGCTCCATAATTTAGG - Intergenic
1146571806 17:33959298-33959320 TTACAGTAGCACCCTACTCCTGG + Intronic
1149131412 17:53306090-53306112 TTACAGCAGCACCCCACTGCTGG + Intergenic
1150062108 17:62077395-62077417 TTCCAGCAAAACCCTACTTCCGG + Intergenic
1151051648 17:70985073-70985095 TTTTAGCAGCACCCCACTCCTGG + Intergenic
1152967566 18:130797-130819 TCTCAGCAACACCCCACTTCTGG + Intergenic
1153929465 18:9865974-9865996 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1154926417 18:20941252-20941274 TCTCAGCAACACCCCACTTCTGG - Intergenic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155349706 18:24894541-24894563 TTTCACCACCACCAGATTTCAGG - Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156583675 18:38408769-38408791 TTTCATCAGCAACCCACTTCTGG - Intergenic
1156858966 18:41814572-41814594 TTTCAGCAGCACCGCACTCCTGG + Intergenic
1157079597 18:44508441-44508463 TTTAAGCACCACCTTTCTTCTGG - Intergenic
1157941004 18:51929213-51929235 TTACAGCAGCACCTCACTCCCGG - Intergenic
1157988861 18:52471561-52471583 TTTCAGCAGCACCTAACTCTGGG + Intronic
1159083319 18:63759979-63760001 TTTCAGCAACACCCCACTCCTGG - Intronic
1159641093 18:70864005-70864027 TTTCAGTAGCACCCCACTACTGG - Intergenic
1159681730 18:71362135-71362157 TTTGAGCAGCTACATACTTGAGG - Intergenic
1159906354 18:74096293-74096315 GTTCAGTAGCACCACACTACAGG + Intronic
1160429094 18:78799245-78799267 TTTCACCAGCACCACACTGCTGG + Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1165478471 19:36046643-36046665 TCTCAGCAGCCCCATTCTTCCGG + Intronic
924993539 2:337142-337164 TTACAGCAGCACCCCACTCCCGG - Intergenic
925022352 2:581630-581652 TTTCATCAGCACCACACTCCCGG - Intergenic
925724350 2:6858813-6858835 TTTCAGCAGCACCCCACTTCTGG - Intronic
926508016 2:13740264-13740286 TTTCTGTAGCACCTCACTTCTGG - Intergenic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926816817 2:16805673-16805695 TTTCAGCAGCACCCCATTTCTGG + Intergenic
926938829 2:18114340-18114362 TTACAGCAGCACCCCACTGCTGG - Intronic
926954111 2:18274912-18274934 TTTCAACTGCACCAGAGTTCTGG + Intronic
927921830 2:26978398-26978420 TTTCCGCAGCACCAGACTCTTGG + Intronic
929211363 2:39360530-39360552 TTACAGCAGCACCCCACTCCTGG + Intronic
930310464 2:49733097-49733119 ATTCAGCAGCACCCCACTCCTGG + Intergenic
930402229 2:50904876-50904898 TTTCAGAAGCATAATCCTTCTGG + Intronic
931073637 2:58684389-58684411 TTTCAACAGCACCATCCCTTAGG + Intergenic
931154791 2:59615725-59615747 TTTCAGTAGTACCCTACTCCTGG + Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932318116 2:70799890-70799912 TTTCAGCAACACCTCACTCCTGG + Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932622916 2:73276442-73276464 TTTCAACATCACCATCCTTTAGG + Intronic
933064278 2:77773897-77773919 TTTCAGCAGCACCTCGCTCCTGG + Intergenic
933645067 2:84805682-84805704 TTTAATCAACACCATACTTGAGG + Exonic
934112904 2:88758902-88758924 TTTCAGCAACACCCTACTCCTGG - Intergenic
934330858 2:92066843-92066865 ATTCAGCAGCACCACATCTCAGG - Intergenic
934918403 2:98320384-98320406 TTACAGCAGCACCCCACTCCTGG - Intergenic
935372961 2:102366568-102366590 TTACAGTAGCACCCCACTTCTGG + Intronic
936169267 2:110154388-110154410 TTTCAGCAACACCCTACTCCTGG - Intronic
936792190 2:116163758-116163780 TTTCAGCAACACCCCACTTCTGG - Intergenic
937935134 2:127237936-127237958 TTATAGCAGCACCCCACTTCTGG - Intergenic
939035326 2:137123706-137123728 TTACAGCTTCAACATACTTCAGG - Intronic
939295900 2:140263895-140263917 TTACAGCAGCACCACAATTCTGG + Intronic
939695038 2:145313102-145313124 TTTCAGCAACACCCTACTCTCGG + Intergenic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940790882 2:158028622-158028644 TTTCAGCAACACCCCATTTCTGG + Intronic
940888951 2:159016023-159016045 TTTCAGTAGCACCCCACTCCTGG + Intronic
941967150 2:171311783-171311805 TTACAGCAGCACCCCACTCCTGG - Intergenic
942419872 2:175796616-175796638 TTTCAGTAGCACCCCACTCCCGG - Intergenic
943478290 2:188386033-188386055 TTTCAGCAGCATCCAACTCCTGG + Intronic
945709378 2:213277322-213277344 TTTCAGCAACACCCCACTCCTGG - Intergenic
945799416 2:214408057-214408079 ATTCAACAGCACCATGCCTCAGG - Intronic
945949570 2:216025738-216025760 TTCCAGCAGCTCCTTCCTTCCGG + Intronic
946930233 2:224663499-224663521 TTTCAGCAACACCCTGCTCCTGG + Intergenic
947345709 2:229187273-229187295 TTTCAGCAGCACCCCACTCCTGG + Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1168966544 20:1901927-1901949 TTTCTACAGCTCCATTCTTCAGG + Intronic
1169099092 20:2930325-2930347 TTTCATAAGCACTCTACTTCTGG - Intronic
1169676517 20:8160355-8160377 TTTCAGCAACACCACACTACTGG + Intronic
1169858112 20:10125065-10125087 TTTCAGTAGCACCCCACTCCTGG + Intergenic
1170066274 20:12314062-12314084 ATTCATCAGCACAATTCTTCAGG + Intergenic
1170644024 20:18180534-18180556 TTTCAGCAACACCCCACTCCTGG + Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1172380257 20:34483767-34483789 CTTCAGCAGCACCCCACTCCTGG + Intronic
1172720065 20:36993142-36993164 TTTCAGCAGCACCCCACTTCTGG - Intergenic
1175296301 20:57911078-57911100 CTTCAGCATCTCCATTCTTCAGG - Intergenic
1175765600 20:61590547-61590569 TTTCAGCAGCTCCACTGTTCCGG - Intronic
1177393301 21:20503108-20503130 TTTCAGCAACACCCCACTCCTGG + Intergenic
1177621765 21:23604537-23604559 TTTAAGCAACACCCCACTTCTGG - Intergenic
1177684634 21:24419818-24419840 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1177742085 21:25167109-25167131 TTTCAGCAACACCCCACTCCTGG - Intergenic
1178099688 21:29254039-29254061 TTTCAGCAACACCCCACTCCTGG + Intronic
1179678354 21:43000232-43000254 TTTCAGCAACACCCCACTCCTGG + Intronic
1179766416 21:43577030-43577052 TGTCAGCGACACCATTCTTCAGG + Intronic
1182815063 22:33155166-33155188 TTTCAGCAGCACCCCACTCTTGG - Intergenic
1183786111 22:40030076-40030098 TTCCAGCTGCACCTTACATCTGG - Exonic
1184374732 22:44104594-44104616 TTTCAGCACCTCCTTTCTTCTGG + Intronic
949603027 3:5621775-5621797 TTTCAGCAACAAAATAATTCAGG - Intergenic
949665161 3:6330836-6330858 TTTCAGCAGTACCCCACTGCTGG - Intergenic
949673419 3:6425447-6425469 TTTCAGCAGCACCTCACTCCTGG + Intergenic
951037547 3:17950717-17950739 TCACAGCAGCACCACACTCCTGG - Intronic
951711279 3:25586626-25586648 TCACAGCAGCACCCTCCTTCTGG + Intronic
951773597 3:26284692-26284714 TTTCAGCAACACCCCACTCCTGG + Intergenic
952022365 3:29039412-29039434 TTACAGCAGCACCCTACTCCTGG - Intergenic
953736994 3:45503605-45503627 TTTCATCAGGACAATAATTCAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957259399 3:77880437-77880459 TTACAGCAGCACCCCACTACTGG - Intergenic
957508323 3:81155061-81155083 TTTCAGCAGCAGCAAAGCTCAGG - Intergenic
958550692 3:95608096-95608118 TTTCAGTAGCACCCCACTCCTGG + Intergenic
959406992 3:105972265-105972287 TTACAGCAACACCCCACTTCTGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
960297961 3:115967534-115967556 TTTCAGCAGCACCCCACTCCTGG + Intronic
960473092 3:118092424-118092446 TTATATCAGCACCCTACTTCTGG - Intergenic
960486402 3:118258484-118258506 TTTCAGCAACAGCCCACTTCTGG - Intergenic
960564517 3:119119145-119119167 TTTCAGCAGCACCTAATTCCTGG + Intronic
961257676 3:125570890-125570912 TTTCAGCAGCTCCCCACTTCCGG - Intronic
961900338 3:130203736-130203758 TTTTAGCAACACCCCACTTCTGG + Intergenic
962636532 3:137337683-137337705 TTATAGCAGCACCATACTCTTGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963270978 3:143285638-143285660 CTTCAGCAGCATCATACCTGAGG + Intronic
963421158 3:145062257-145062279 TTTCAGCAGCACCCCACTCGTGG + Intergenic
963593104 3:147287363-147287385 TTTCAGCAACACTCCACTTCTGG + Intergenic
965719862 3:171649914-171649936 GCTCAGTAGCACAATACTTCTGG + Intronic
965854011 3:173066153-173066175 TTTCTGAAGCACCAAATTTCAGG + Intronic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
967462395 3:189761682-189761704 TTTCAGCAACACCACACTTCTGG + Intronic
967717020 3:192774527-192774549 TTTCAGCAACACCCCACTTCTGG - Intergenic
968265471 3:197359659-197359681 TTTCAGCAGCACCCCACTCTTGG - Intergenic
968892960 4:3381377-3381399 TTACGGCAGCACCCTACTTCTGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
969742761 4:9044974-9044996 TTTTAGCAACACCCCACTTCTGG - Intergenic
970624518 4:17862101-17862123 TTTCAGCAGCACCCCACTCTTGG + Intronic
970698635 4:18708982-18709004 TTACAGCAGCACCTTACTTCTGG + Intergenic
970868266 4:20783305-20783327 TTTCAGCAACATCCCACTTCTGG + Intronic
971035293 4:22686323-22686345 TTCCAGCAGCAGCATCTTTCAGG - Intergenic
971687561 4:29788306-29788328 TTTCAGTAGCACCCCACTCCTGG + Intergenic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
972242186 4:37204930-37204952 TTTCAGCAGCACCCCACTCCTGG + Intergenic
975186408 4:71409180-71409202 TTTCAGCAACACCCCACTTCTGG - Intronic
975216397 4:71760990-71761012 TTTCAGCAGCACCGCACTCCTGG - Intronic
975796414 4:78011200-78011222 TTACAGCAGCACCCCACTCCCGG - Intergenic
977393832 4:96447850-96447872 TTTCAGCAGCACCGCAGTTCTGG - Intergenic
977715411 4:100177064-100177086 TTTCATCAGCTCCTTTCTTCTGG + Intergenic
979063452 4:116097545-116097567 TTTCAGCAACACCCCACTCCTGG - Intergenic
979426521 4:120573403-120573425 TTTCAGTAGCACTGCACTTCTGG + Intergenic
979497869 4:121404903-121404925 TTTCAACAGCAACATACTAAAGG - Intergenic
980134490 4:128846680-128846702 ATTCAGGAGCAACATACTTCAGG + Intronic
980308755 4:131100155-131100177 TTTCAGCAGCATGCTACTCCTGG - Intergenic
980728088 4:136790576-136790598 GTTCAGCAGCACAATATTTCTGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981799456 4:148638262-148638284 TTTCAGCAACACCCGACTCCTGG + Intergenic
981886334 4:149677318-149677340 TTTAAGCAGCATCACACTCCAGG + Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982121357 4:152146439-152146461 TTTCAGCAACACCCCACTCCTGG + Intergenic
982299782 4:153866951-153866973 TTACAGCAGCACCCCACTCCTGG - Intergenic
982897324 4:160949256-160949278 TTTCAGCTTCAACATACTTCAGG + Intergenic
983068227 4:163236573-163236595 TTTCAGCAACACCTCACTCCTGG + Intergenic
983322522 4:166212524-166212546 TTTCAGCAACACCCCACTCCTGG + Intergenic
983437128 4:167730328-167730350 TTTCATTAGCACCCTACTCCTGG - Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
983668977 4:170214312-170214334 TTCCAGCAGCACCTCACTCCTGG - Intergenic
983718388 4:170815404-170815426 TTACAGCAGCACCTCACTCCTGG - Intergenic
983941032 4:173534330-173534352 TTTGAGCAGCACGACACTTCTGG - Intergenic
984200084 4:176708550-176708572 CTTGAGCAGCACCATAATTAAGG + Intronic
986412754 5:7497845-7497867 TTTCAGTAGCACCAGACTGAAGG + Intronic
986505959 5:8451599-8451621 CTTCAGCAGCCCCATTCTTCAGG + Intergenic
986553942 5:8991235-8991257 TGTCAGCATCACCATGCTGCAGG - Intergenic
987033565 5:13997730-13997752 TTACAGCAGCACCCCACTTCTGG + Intergenic
987102693 5:14606000-14606022 TTTCAGCAGCACCCCAGTCCTGG + Intronic
987103902 5:14617913-14617935 CTTCAGCCACACCATACTTGAGG - Intergenic
987607811 5:20160725-20160747 TTACAGCAGCACCCAACTTCAGG + Intronic
987733171 5:21803586-21803608 CCACAGCAGCACCATATTTCAGG - Intronic
987799404 5:22674521-22674543 TTTCAGCAGCACCCCACTCCTGG - Intronic
988959460 5:36355179-36355201 TTTCTGCATCACTAAACTTCAGG + Intergenic
989673527 5:43947224-43947246 TTTCAGCAGCACTGCACTCCTGG + Intergenic
989678561 5:44002913-44002935 TTTCAGCAGCATCCTGGTTCAGG + Intergenic
990077729 5:51872322-51872344 TTACAGCAGCACCCCACTCCTGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992231391 5:74667622-74667644 TTGCAGCAGCACTTGACTTCTGG - Intronic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
994879001 5:105461823-105461845 TTACAGCAGTACCCTACTCCTGG + Intergenic
995220265 5:109640528-109640550 TTTCAGCAGCACCTCACTCTTGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995333936 5:110977122-110977144 TTTCAGCAGCACTCCACTCCTGG + Intergenic
997274734 5:132575073-132575095 TTTCAGCAGCACTCCACTCCTGG + Intronic
997385453 5:133468608-133468630 TATCAGCAGCACCACCATTCAGG + Intronic
997758457 5:136422180-136422202 TCTGGGCAGCACCATACTACTGG - Intergenic
998144422 5:139718589-139718611 TTTCAGCAGCACCCCACTCCTGG - Intergenic
999051605 5:148529644-148529666 TTTCATCAGCACCCCACTCCTGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000676446 5:164127726-164127748 TTTCAGCAACACCCCACTCCTGG + Intergenic
1000741364 5:164973985-164974007 TTTCAGCAGCACCCCACTTGTGG - Intergenic
1000784538 5:165527745-165527767 TTACAGCAGCACCCCACTCCTGG - Intergenic
1001684030 5:173579157-173579179 TTCCATCAGCACCCCACTTCTGG + Intergenic
1001795394 5:174498153-174498175 TTTCAGCAGCACCCCACTCCTGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1005153492 6:22778612-22778634 TTACAGCAGCACCCCACTTCTGG - Intergenic
1007856729 6:44865372-44865394 TTTCAGCAGCACCCCACTCCTGG + Intronic
1008025395 6:46630195-46630217 TTTCACCAGCACCATTCATGCGG + Intronic
1009825357 6:68859406-68859428 TTTCAGCAACACCCCACTCCTGG + Intronic
1011598408 6:89038081-89038103 TTACAGCAGCACCCCACTCCTGG + Intergenic
1013918045 6:115365964-115365986 TTTCAGCAGCACCTCACTCCTGG - Intergenic
1014327703 6:120019211-120019233 TTTCAGCAGCACCACATTTCTGG + Intergenic
1014449261 6:121564699-121564721 TTTCAGCAACACCCCACTTCTGG - Intergenic
1014657674 6:124128249-124128271 TTTCAACTGCACCATAATGCAGG - Intronic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1015630793 6:135230076-135230098 TTTCAGCAGCAACAATATTCAGG + Intergenic
1016209088 6:141506264-141506286 TTTCAGCAACACCCCACTCCTGG + Intergenic
1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG + Intronic
1016540481 6:145158830-145158852 TTACAGCAGCACCCCACTCCTGG - Intergenic
1016564987 6:145442282-145442304 TTTCAGCAGAACCCCACTCCCGG + Intergenic
1017353400 6:153472218-153472240 TTCCAGCAGCCTCAGACTTCTGG + Intergenic
1021162639 7:17295790-17295812 ATTCTGCAGCTCCTTACTTCAGG - Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1022909250 7:34884029-34884051 TTTCAGCAACACCCCACTCCTGG + Intergenic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1026365382 7:69643398-69643420 TGTCAGCCACACCATATTTCAGG + Intronic
1027506230 7:79019903-79019925 TTACAGCAGCACCCCACTCCTGG - Intronic
1027520839 7:79204434-79204456 TTGCAGCTGCACCAGGCTTCTGG + Intronic
1028022680 7:85796383-85796405 TTTCAGTAGTTTCATACTTCAGG - Intergenic
1028133754 7:87205892-87205914 TTACAGCAGCACCCCACTCCTGG + Intronic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1028745419 7:94321312-94321334 TTTCAGCAACACCCCACTCCTGG + Intergenic
1028790057 7:94843744-94843766 TTTCAGCAACACCCCACTCCTGG - Intergenic
1028904371 7:96136612-96136634 CTTTATCAGCACCATCCTTCAGG - Intronic
1028947106 7:96592550-96592572 TTTCAGCAGCACCATGACACCGG + Intronic
1029070602 7:97892938-97892960 TTTTAGCAACACCCCACTTCTGG + Intergenic
1030778034 7:113561117-113561139 TTTCAGCAACTCTAGACTTCAGG - Intergenic
1030784851 7:113646517-113646539 TTACAGCAGCTCCCCACTTCTGG + Intergenic
1030810000 7:113960106-113960128 TTTTAGCAGCACCTCACTCCTGG + Intronic
1031290395 7:119927618-119927640 TTCCAGCAGCACCTGACTTCTGG - Intergenic
1031559058 7:123215532-123215554 TTTCAGCAGTACCCCACTCCTGG - Intergenic
1031803377 7:126276593-126276615 TTATAGCAGCACCCCACTTCTGG + Intergenic
1032179328 7:129661821-129661843 TTTCAGCAGCACCCCACTCCTGG + Intronic
1033031697 7:137833187-137833209 TTTCAGCAGCACCCTACTCCTGG + Intronic
1033247460 7:139729830-139729852 TTTCAGCAGTACCAGTTTTCAGG + Intronic
1033719067 7:144037654-144037676 TTACAGCAGCAGCACTCTTCAGG - Intergenic
1033777453 7:144628592-144628614 TTACAGCAGCACCCTTCTCCTGG - Intronic
1034186402 7:149180782-149180804 TTTCTGAAGCTCCATGCTTCTGG - Intronic
1036886286 8:12556211-12556233 TTTTAGCAACACCCCACTTCTGG + Intergenic
1039071271 8:33651253-33651275 TTACAGCAGCACCCCACTTCTGG - Intergenic
1041965029 8:63666647-63666669 GTTCAGCAGTACCCCACTTCTGG - Intergenic
1042231782 8:66563249-66563271 TTTCTATAGCAGCATACTTCAGG + Exonic
1042275849 8:67004323-67004345 TATCAGCAGAAACCTACTTCTGG - Intronic
1043037413 8:75215335-75215357 TTTCACCTGCAGCATAATTCTGG + Intergenic
1043195399 8:77286915-77286937 ATTCAGGAGCACCATCCTCCTGG + Intergenic
1043262312 8:78217928-78217950 TTGCAGCAGCAACATATTTTTGG - Intergenic
1044017263 8:87059382-87059404 TTATAGCAGCACCCTACTTCTGG + Intronic
1044324945 8:90848457-90848479 TTACAGCAGCACCCCACTACTGG + Intronic
1044877107 8:96680643-96680665 TTTCAGCAGCACCCCACTCCTGG - Intronic
1045229726 8:100291877-100291899 TTTTAGAAGTACCATACATCTGG - Intronic
1045588286 8:103563665-103563687 TTTCAGTAGCACCCCACTCCTGG + Intronic
1046093973 8:109536595-109536617 GTTCAGCCACATCATACTTCTGG - Intergenic
1046276779 8:111971575-111971597 TCTCTGCAGCCCCAAACTTCTGG - Intergenic
1046506858 8:115147545-115147567 TTTCAGCAGCACCTCACTTCTGG + Intergenic
1046822179 8:118646252-118646274 TCTCAGCAGGACCATAAATCAGG + Intergenic
1047149050 8:122240486-122240508 TTTCAGCAGCGCCCCACTCCTGG - Intergenic
1048491263 8:134895970-134895992 TACCAGCACCACCATCCTTCTGG + Intergenic
1048726253 8:137388279-137388301 TTACAGTAGCACCCTACTCCTGG + Intergenic
1048895874 8:138991707-138991729 TTTCAGGAACACCCCACTTCTGG + Intergenic
1050079690 9:1903507-1903529 TTTCAGCAGCACCCCACTCCTGG - Intergenic
1050095417 9:2060039-2060061 GCTCAGCAGTACCAGACTTCAGG + Intronic
1050188635 9:3001678-3001700 TTTCAGCAACATCATACTAATGG + Intergenic
1050255506 9:3788575-3788597 TTTCAGCAGTGCCCCACTTCTGG - Intergenic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052782671 9:32796853-32796875 TTTCAGCAGCATCCAACTCCTGG + Intergenic
1055443810 9:76363062-76363084 TTAAAGCTGCACAATACTTCAGG - Intergenic
1056179267 9:84065972-84065994 TTTCAGGAGGATAATACTTCAGG - Intergenic
1057091261 9:92260155-92260177 GGGCATCAGCACCATACTTCTGG + Exonic
1057316584 9:93972846-93972868 TTTCAGCAACACCCTGCTTCTGG + Intergenic
1058230229 9:102416444-102416466 TTTCAGCAACACCCCACTCCTGG - Intergenic
1058288678 9:103210793-103210815 TTTGAGCAGCACCCCACTCCTGG + Intergenic
1059481277 9:114592173-114592195 TTTAATCAGCAGCATACTTAAGG + Intronic
1059482460 9:114601973-114601995 TTTTAGCAGCACCCCACTCCTGG + Intergenic
1060959216 9:127667308-127667330 TTTCATCATCATCATATTTCAGG - Intronic
1061630218 9:131867598-131867620 TTCAAGCAGCACCATTCTTAAGG - Intronic
1062226396 9:135454778-135454800 GTACAGCAGCACCCCACTTCTGG + Intergenic
1186281718 X:8000123-8000145 ATTCTGAAGCAACATACTTCTGG + Intergenic
1186708729 X:12170646-12170668 TTTAAGCTGCTCCATTCTTCTGG + Intronic
1188599014 X:31938638-31938660 ATTCAGCAGTACTATACCTCAGG - Intronic
1188748323 X:33874163-33874185 TTTCAACAGCACCCCACTGCTGG + Intergenic
1189357024 X:40317808-40317830 CTTCAGGACGACCATACTTCAGG + Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193016298 X:76737934-76737956 TGGCAGCAGCAGCATAGTTCAGG + Intergenic
1193043241 X:77025490-77025512 TTACAGCAGCACCCCACTCCTGG + Intergenic
1193153324 X:78147345-78147367 TTTCAGCAGCACCCCACTTCTGG - Intergenic
1193221726 X:78934712-78934734 TTCCAGCAGCACCACAGCTCTGG - Intergenic
1193631187 X:83890166-83890188 TTACAGCAGCATCACACTCCTGG + Intergenic
1194321020 X:92446719-92446741 TTTCAGCAGCACCCTACTCCTGG - Intronic
1194496456 X:94622184-94622206 TTTCAGCAACACCCTACTTCTGG + Intergenic
1196173264 X:112613092-112613114 TTTCAGGAGCTCCATAATCCTGG + Intergenic
1196664954 X:118305998-118306020 TTTCAGCAGCACCCCACTCCTGG + Intergenic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1198568898 X:137934425-137934447 TTTCAGCAGCACCCCACTCCTGG - Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199515371 X:148669364-148669386 TTTCAGCAGCACCCCACTCCTGG + Intronic
1200629138 Y:5559866-5559888 TTTCAGCAGCACCCTACTCCTGG - Intronic
1200878174 Y:8181453-8181475 TTTCGGCAGCACCCCACTCCTGG + Intergenic
1200902983 Y:8451838-8451860 TTTCACCAGGGCCATGCTTCAGG + Intergenic
1201469332 Y:14316674-14316696 TTTCAGCAACACCCTACTCAAGG - Intergenic