ID: 1016293220

View in Genome Browser
Species Human (GRCh38)
Location 6:142546265-142546287
Sequence GGTTTAGGTTCCACTCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016293215_1016293220 16 Left 1016293215 6:142546226-142546248 CCAAAAATTAATATTGATGTTTC No data
Right 1016293220 6:142546265-142546287 GGTTTAGGTTCCACTCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016293220 Original CRISPR GGTTTAGGTTCCACTCTTAA TGG Intergenic
No off target data available for this crispr