ID: 1016294915

View in Genome Browser
Species Human (GRCh38)
Location 6:142563971-142563993
Sequence CTCCATTCAAAAACTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016294905_1016294915 26 Left 1016294905 6:142563922-142563944 CCCTCAGTGAAGATCTGCTCCTG No data
Right 1016294915 6:142563971-142563993 CTCCATTCAAAAACTGGCCAAGG No data
1016294906_1016294915 25 Left 1016294906 6:142563923-142563945 CCTCAGTGAAGATCTGCTCCTGA No data
Right 1016294915 6:142563971-142563993 CTCCATTCAAAAACTGGCCAAGG No data
1016294910_1016294915 -10 Left 1016294910 6:142563958-142563980 CCTCACCCAGGTCCTCCATTCAA No data
Right 1016294915 6:142563971-142563993 CTCCATTCAAAAACTGGCCAAGG No data
1016294908_1016294915 7 Left 1016294908 6:142563941-142563963 CCTGAAGTTCATAGGTTCCTCAC No data
Right 1016294915 6:142563971-142563993 CTCCATTCAAAAACTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016294915 Original CRISPR CTCCATTCAAAAACTGGCCA AGG Intergenic
No off target data available for this crispr