ID: 1016295130

View in Genome Browser
Species Human (GRCh38)
Location 6:142565672-142565694
Sequence CACAGTTGCCGCTTTAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016295129_1016295130 -8 Left 1016295129 6:142565657-142565679 CCAACAGCGGAGAAACACAGTTG No data
Right 1016295130 6:142565672-142565694 CACAGTTGCCGCTTTAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016295130 Original CRISPR CACAGTTGCCGCTTTAATGA TGG Intergenic
No off target data available for this crispr