ID: 1016295510

View in Genome Browser
Species Human (GRCh38)
Location 6:142569182-142569204
Sequence AAGGAAGACTATAATGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016295510_1016295514 -1 Left 1016295510 6:142569182-142569204 CCAACCACATTATAGTCTTCCTT No data
Right 1016295514 6:142569204-142569226 TTGGTTCAGAAAATCTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016295510 Original CRISPR AAGGAAGACTATAATGTGGT TGG (reversed) Intergenic
No off target data available for this crispr