ID: 1016297016

View in Genome Browser
Species Human (GRCh38)
Location 6:142584289-142584311
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016297012_1016297016 11 Left 1016297012 6:142584255-142584277 CCTTTAAGGAATCAAACTTGACT 0: 115
1: 183
2: 150
3: 142
4: 232
Right 1016297016 6:142584289-142584311 TAAATCTCCTTGGGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016297016 Original CRISPR TAAATCTCCTTGGGAAAAAC TGG Intergenic
No off target data available for this crispr