ID: 1016297016 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:142584289-142584311 |
| Sequence | TAAATCTCCTTGGGAAAAAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1016297012_1016297016 | 11 | Left | 1016297012 | 6:142584255-142584277 | CCTTTAAGGAATCAAACTTGACT | 0: 115 1: 183 2: 150 3: 142 4: 232 |
||
| Right | 1016297016 | 6:142584289-142584311 | TAAATCTCCTTGGGAAAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1016297016 | Original CRISPR | TAAATCTCCTTGGGAAAAAC TGG | Intergenic | ||
| No off target data available for this crispr | |||||