ID: 1016297793

View in Genome Browser
Species Human (GRCh38)
Location 6:142593950-142593972
Sequence CTCTGTCTTCTCAACAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016297793_1016297796 7 Left 1016297793 6:142593950-142593972 CCAAAGTTGTTGAGAAGACAGAG No data
Right 1016297796 6:142593980-142594002 AATTCTCATACATAGCTGATGGG No data
1016297793_1016297795 6 Left 1016297793 6:142593950-142593972 CCAAAGTTGTTGAGAAGACAGAG No data
Right 1016297795 6:142593979-142594001 GAATTCTCATACATAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016297793 Original CRISPR CTCTGTCTTCTCAACAACTT TGG (reversed) Intergenic
No off target data available for this crispr