ID: 1016302985

View in Genome Browser
Species Human (GRCh38)
Location 6:142652514-142652536
Sequence CTGCAAAGATGGAAGGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016302980_1016302985 -10 Left 1016302980 6:142652501-142652523 CCTCCTGGAAGACCTGCAAAGAT No data
Right 1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG No data
1016302978_1016302985 2 Left 1016302978 6:142652489-142652511 CCCATCTGCTTGCCTCCTGGAAG No data
Right 1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG No data
1016302976_1016302985 12 Left 1016302976 6:142652479-142652501 CCTTGTCGGTCCCATCTGCTTGC No data
Right 1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG No data
1016302979_1016302985 1 Left 1016302979 6:142652490-142652512 CCATCTGCTTGCCTCCTGGAAGA No data
Right 1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016302985 Original CRISPR CTGCAAAGATGGAAGGCAGA CGG Intergenic
No off target data available for this crispr