ID: 1016302992

View in Genome Browser
Species Human (GRCh38)
Location 6:142652588-142652610
Sequence AAACCTACTAACACCTACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016302989_1016302992 5 Left 1016302989 6:142652560-142652582 CCCAGCCGTCTATTTCTCTTTCA No data
Right 1016302992 6:142652588-142652610 AAACCTACTAACACCTACTATGG No data
1016302991_1016302992 0 Left 1016302991 6:142652565-142652587 CCGTCTATTTCTCTTTCATTAGA No data
Right 1016302992 6:142652588-142652610 AAACCTACTAACACCTACTATGG No data
1016302990_1016302992 4 Left 1016302990 6:142652561-142652583 CCAGCCGTCTATTTCTCTTTCAT No data
Right 1016302992 6:142652588-142652610 AAACCTACTAACACCTACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016302992 Original CRISPR AAACCTACTAACACCTACTA TGG Intergenic
No off target data available for this crispr