ID: 1016303053

View in Genome Browser
Species Human (GRCh38)
Location 6:142653141-142653163
Sequence GGTCATGGGTTCATGGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016303045_1016303053 8 Left 1016303045 6:142653110-142653132 CCAAGCAAATACACCACTGGGTA No data
Right 1016303053 6:142653141-142653163 GGTCATGGGTTCATGGGTACAGG No data
1016303042_1016303053 18 Left 1016303042 6:142653100-142653122 CCATTGTGCTCCAAGCAAATACA No data
Right 1016303053 6:142653141-142653163 GGTCATGGGTTCATGGGTACAGG No data
1016303048_1016303053 -5 Left 1016303048 6:142653123-142653145 CCACTGGGTAAGAGAGGAGGTCA No data
Right 1016303053 6:142653141-142653163 GGTCATGGGTTCATGGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016303053 Original CRISPR GGTCATGGGTTCATGGGTAC AGG Intergenic
No off target data available for this crispr