ID: 1016305293

View in Genome Browser
Species Human (GRCh38)
Location 6:142677823-142677845
Sequence CATAAAAAGGAGAGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016305293_1016305298 -4 Left 1016305293 6:142677823-142677845 CCTGCCTGCCTCTCCTTTTTATG No data
Right 1016305298 6:142677842-142677864 TATGAACTTGGCCCTTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016305293 Original CRISPR CATAAAAAGGAGAGGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr