ID: 1016305298

View in Genome Browser
Species Human (GRCh38)
Location 6:142677842-142677864
Sequence TATGAACTTGGCCCTTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016305292_1016305298 29 Left 1016305292 6:142677790-142677812 CCTACGATGAATGGTGACATAAG No data
Right 1016305298 6:142677842-142677864 TATGAACTTGGCCCTTTGTCAGG No data
1016305294_1016305298 -8 Left 1016305294 6:142677827-142677849 CCTGCCTCTCCTTTTTATGAACT No data
Right 1016305298 6:142677842-142677864 TATGAACTTGGCCCTTTGTCAGG No data
1016305293_1016305298 -4 Left 1016305293 6:142677823-142677845 CCTGCCTGCCTCTCCTTTTTATG No data
Right 1016305298 6:142677842-142677864 TATGAACTTGGCCCTTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016305298 Original CRISPR TATGAACTTGGCCCTTTGTC AGG Intergenic
No off target data available for this crispr