ID: 1016306644

View in Genome Browser
Species Human (GRCh38)
Location 6:142691682-142691704
Sequence TATCCTTTCCTGCTGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016306643_1016306644 -6 Left 1016306643 6:142691665-142691687 CCATGGCTGGGAATGTATATCCT No data
Right 1016306644 6:142691682-142691704 TATCCTTTCCTGCTGCTCACTGG No data
1016306642_1016306644 -5 Left 1016306642 6:142691664-142691686 CCCATGGCTGGGAATGTATATCC No data
Right 1016306644 6:142691682-142691704 TATCCTTTCCTGCTGCTCACTGG No data
1016306636_1016306644 24 Left 1016306636 6:142691635-142691657 CCTTGGCCACACATGCGGATAAA No data
Right 1016306644 6:142691682-142691704 TATCCTTTCCTGCTGCTCACTGG No data
1016306638_1016306644 18 Left 1016306638 6:142691641-142691663 CCACACATGCGGATAAAGGATTG No data
Right 1016306644 6:142691682-142691704 TATCCTTTCCTGCTGCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016306644 Original CRISPR TATCCTTTCCTGCTGCTCAC TGG Intergenic
No off target data available for this crispr