ID: 1016307202

View in Genome Browser
Species Human (GRCh38)
Location 6:142696780-142696802
Sequence CTGAGGGGAGCATCTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016307202_1016307212 10 Left 1016307202 6:142696780-142696802 CCTGGGACAGATGCTCCCCTCAG No data
Right 1016307212 6:142696813-142696835 AGGTTGTTTACCCTGGCCCCTGG No data
1016307202_1016307218 30 Left 1016307202 6:142696780-142696802 CCTGGGACAGATGCTCCCCTCAG No data
Right 1016307218 6:142696833-142696855 TGGCCATTTCCTGCCCCGTTTGG No data
1016307202_1016307208 3 Left 1016307202 6:142696780-142696802 CCTGGGACAGATGCTCCCCTCAG No data
Right 1016307208 6:142696806-142696828 CTGCCCCAGGTTGTTTACCCTGG No data
1016307202_1016307203 -10 Left 1016307202 6:142696780-142696802 CCTGGGACAGATGCTCCCCTCAG No data
Right 1016307203 6:142696793-142696815 CTCCCCTCAGCTCCTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016307202 Original CRISPR CTGAGGGGAGCATCTGTCCC AGG (reversed) Intergenic
No off target data available for this crispr