ID: 1016307206

View in Genome Browser
Species Human (GRCh38)
Location 6:142696797-142696819
Sequence ACAACCTGGGGCAGGAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016307206_1016307212 -7 Left 1016307206 6:142696797-142696819 CCTCAGCTCCTGCCCCAGGTTGT No data
Right 1016307212 6:142696813-142696835 AGGTTGTTTACCCTGGCCCCTGG No data
1016307206_1016307218 13 Left 1016307206 6:142696797-142696819 CCTCAGCTCCTGCCCCAGGTTGT No data
Right 1016307218 6:142696833-142696855 TGGCCATTTCCTGCCCCGTTTGG No data
1016307206_1016307220 21 Left 1016307206 6:142696797-142696819 CCTCAGCTCCTGCCCCAGGTTGT No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016307206 Original CRISPR ACAACCTGGGGCAGGAGCTG AGG (reversed) Intergenic
No off target data available for this crispr