ID: 1016307209

View in Genome Browser
Species Human (GRCh38)
Location 6:142696809-142696831
Sequence GGGCCAGGGTAAACAACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016307209_1016307218 1 Left 1016307209 6:142696809-142696831 CCCCAGGTTGTTTACCCTGGCCC No data
Right 1016307218 6:142696833-142696855 TGGCCATTTCCTGCCCCGTTTGG No data
1016307209_1016307220 9 Left 1016307209 6:142696809-142696831 CCCCAGGTTGTTTACCCTGGCCC No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016307209 Original CRISPR GGGCCAGGGTAAACAACCTG GGG (reversed) Intergenic
No off target data available for this crispr