ID: 1016307220

View in Genome Browser
Species Human (GRCh38)
Location 6:142696841-142696863
Sequence TCCTGCCCCGTTTGGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016307210_1016307220 8 Left 1016307210 6:142696810-142696832 CCCAGGTTGTTTACCCTGGCCCC No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data
1016307206_1016307220 21 Left 1016307206 6:142696797-142696819 CCTCAGCTCCTGCCCCAGGTTGT No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data
1016307207_1016307220 13 Left 1016307207 6:142696805-142696827 CCTGCCCCAGGTTGTTTACCCTG No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data
1016307214_1016307220 -6 Left 1016307214 6:142696824-142696846 CCTGGCCCCTGGCCATTTCCTGC No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data
1016307211_1016307220 7 Left 1016307211 6:142696811-142696833 CCAGGTTGTTTACCCTGGCCCCT No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data
1016307205_1016307220 22 Left 1016307205 6:142696796-142696818 CCCTCAGCTCCTGCCCCAGGTTG No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data
1016307209_1016307220 9 Left 1016307209 6:142696809-142696831 CCCCAGGTTGTTTACCCTGGCCC No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data
1016307213_1016307220 -5 Left 1016307213 6:142696823-142696845 CCCTGGCCCCTGGCCATTTCCTG No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data
1016307204_1016307220 23 Left 1016307204 6:142696795-142696817 CCCCTCAGCTCCTGCCCCAGGTT No data
Right 1016307220 6:142696841-142696863 TCCTGCCCCGTTTGGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016307220 Original CRISPR TCCTGCCCCGTTTGGCACCC AGG Intergenic
No off target data available for this crispr