ID: 1016317331

View in Genome Browser
Species Human (GRCh38)
Location 6:142805278-142805300
Sequence ACAGCTTGTGCTCCCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016317321_1016317331 29 Left 1016317321 6:142805226-142805248 CCTGGTATGTGACCCTGGCCACT 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG 0: 1
1: 0
2: 0
3: 16
4: 147
1016317329_1016317331 -6 Left 1016317329 6:142805261-142805283 CCTGTGCACAAGAGGGAACAGCT 0: 1
1: 0
2: 1
3: 4
4: 124
Right 1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG 0: 1
1: 0
2: 0
3: 16
4: 147
1016317325_1016317331 2 Left 1016317325 6:142805253-142805275 CCAGCCAGCCTGTGCACAAGAGG 0: 1
1: 0
2: 1
3: 27
4: 392
Right 1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG 0: 1
1: 0
2: 0
3: 16
4: 147
1016317324_1016317331 11 Left 1016317324 6:142805244-142805266 CCACTTGTACCAGCCAGCCTGTG 0: 1
1: 0
2: 1
3: 18
4: 181
Right 1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG 0: 1
1: 0
2: 0
3: 16
4: 147
1016317322_1016317331 17 Left 1016317322 6:142805238-142805260 CCCTGGCCACTTGTACCAGCCAG 0: 1
1: 1
2: 1
3: 9
4: 145
Right 1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG 0: 1
1: 0
2: 0
3: 16
4: 147
1016317328_1016317331 -2 Left 1016317328 6:142805257-142805279 CCAGCCTGTGCACAAGAGGGAAC 0: 1
1: 0
2: 3
3: 69
4: 948
Right 1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG 0: 1
1: 0
2: 0
3: 16
4: 147
1016317323_1016317331 16 Left 1016317323 6:142805239-142805261 CCTGGCCACTTGTACCAGCCAGC 0: 1
1: 1
2: 1
3: 14
4: 166
Right 1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG 0: 1
1: 0
2: 0
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016317331 Original CRISPR ACAGCTTGTGCTCCCCATGG AGG Intronic
900390342 1:2431176-2431198 GCCGCTTCTGCTCCCCCTGGGGG + Intronic
900430284 1:2598135-2598157 ACAGCTTATGCTCAGCATCGTGG + Intronic
901411868 1:9089839-9089861 ACAGCTGGCACTGCCCATGGAGG + Intergenic
902534677 1:17112621-17112643 ACACCTGGTGCTCGGCATGGTGG + Intronic
903167781 1:21533012-21533034 AAAGCTTGTGCTCCCCACCATGG - Intronic
904842026 1:33379132-33379154 ACAGCCACTGCTCCCCATGCAGG + Intronic
904891312 1:33781821-33781843 ACAGCTGGTCGCCCCCATGGAGG + Intronic
911530621 1:99039379-99039401 ACAGTGGGTGCTGCCCATGGAGG + Intergenic
911693718 1:100863778-100863800 ACAGCTTGTGCTCCACACCCAGG - Intergenic
912655034 1:111478343-111478365 ACAGCCTGTGAGCCCCTTGGGGG + Exonic
914232218 1:145773919-145773941 ACAGCCTGTGTTCCCCATGCTGG - Intronic
919760916 1:201097531-201097553 AGAGCTGGTGCTCCCTGTGGGGG - Intronic
920818671 1:209359920-209359942 CCAGCTTGTGCTTTTCATGGTGG + Intergenic
1062999759 10:1905686-1905708 ACAGCTTGTGCGCCCCAGGATGG + Intergenic
1065231097 10:23599103-23599125 ACAGTGTGTGCAGCCCATGGAGG - Intergenic
1067047462 10:42992565-42992587 AGAGCTTGTGCTGCTCTTGGGGG + Intergenic
1068642976 10:59431949-59431971 ACAGCTTGTGTTCTCCATCTAGG - Intergenic
1069716048 10:70522155-70522177 AAGGCTTGTGCCCCGCATGGTGG + Intronic
1069832133 10:71287854-71287876 GCACCTTCTGCTCCCCATGCTGG - Intronic
1076100065 10:127770091-127770113 GCAGCTTGCCCTCCCCATTGTGG + Intergenic
1079121981 11:17692500-17692522 TGAGCTTGTGCTCACCATAGGGG + Intergenic
1079581058 11:22065515-22065537 ACAGCTTGTGTTATCCATAGTGG + Intergenic
1084792113 11:71481534-71481556 ACAGACTAAGCTCCCCATGGAGG - Intronic
1085687157 11:78633640-78633662 ACAGCTTATGCAGGCCATGGTGG + Intergenic
1086800824 11:91172667-91172689 ACAGCATTTGTTCCCCCTGGAGG - Intergenic
1090642651 11:128742503-128742525 ACAGCCTGTGCTCTCCAAGATGG + Intronic
1091277161 11:134360389-134360411 ACTGCTGGTCCTCCCCATGCCGG - Intronic
1091282886 11:134391905-134391927 CCAGCTTCTGCTCCCCATCTGGG - Exonic
1091631821 12:2167547-2167569 TCAGCTTCTGCCCCCCATGGAGG - Intronic
1094045687 12:26163910-26163932 ACTGCTTTTGCTCACCTTGGTGG - Intronic
1095762139 12:45851529-45851551 ACAGTTTGTACTCCCCCTGAGGG - Exonic
1098006294 12:66000081-66000103 TAAGCTTGTGCTGTCCATGGTGG + Intergenic
1102051295 12:109864037-109864059 CCAGCTTCTGCTGACCATGGTGG - Intronic
1102510230 12:113410206-113410228 ACAGCTGGTGCTCCCATTGCTGG + Intronic
1103708020 12:122889810-122889832 CCAGGGTGTGCGCCCCATGGTGG - Intronic
1106336118 13:28784495-28784517 ACAGCAGGTGCAGCCCATGGAGG - Intergenic
1108040057 13:46331628-46331650 AGAGCCTGTGGTCCCCTTGGTGG + Intergenic
1109293657 13:60504765-60504787 ACAGTGTGTGCAGCCCATGGAGG + Intronic
1109479373 13:62928760-62928782 ACAGCAGGTGCTCCACATCGAGG + Intergenic
1111924951 13:94453229-94453251 ACAGATTTTGGTACCCATGGTGG + Intronic
1112129841 13:96510519-96510541 AGAGCTGCTGCTACCCATGGTGG - Intronic
1112386672 13:98946346-98946368 CCAGCTTGTTCTCCCCCTGTTGG - Intronic
1113552018 13:111199967-111199989 ACTGTATGTGCTCCCAATGGAGG - Intronic
1115359898 14:32488811-32488833 CCTGCTTCTGCTCCCCTTGGTGG + Intronic
1118978853 14:70700114-70700136 ACAGCCTGGTCACCCCATGGTGG + Intergenic
1122346665 14:101065212-101065234 AGACCTTGTGCTGCCCTTGGGGG + Intergenic
1125249324 15:37681480-37681502 ACTGCTTATGCTCCACATGGAGG - Intergenic
1126743516 15:51801646-51801668 ACCGATTGTTCTTCCCATGGGGG - Intronic
1126896376 15:53261376-53261398 ACACCTTGTGCTTCCAATGTTGG + Intergenic
1127264945 15:57353618-57353640 CCAGCTTGTGCTCCACACTGGGG - Intergenic
1127600078 15:60526649-60526671 ACAGCTTGTCCTCCCCCAGGTGG + Intronic
1135217716 16:20587368-20587390 AGAGATGATGCTCCCCATGGGGG + Intergenic
1139962597 16:70726419-70726441 AGGGCTTGTGCTTCCCAGGGTGG - Intronic
1140487577 16:75305893-75305915 ACAGCCTGTGCTCCACTTGCTGG + Intronic
1142717341 17:1754480-1754502 AAAACTTGTGCCCCCCATGGAGG + Exonic
1144456956 17:15426649-15426671 ACAGCATGGCCTCCCCATGCAGG - Intergenic
1146101780 17:29990025-29990047 AGAACTTGTGCTCCCCATTGTGG + Intronic
1150549106 17:66192343-66192365 CCAGCTTGTGGGCCCCTTGGCGG + Intergenic
1152233381 17:79125901-79125923 ACAGCCTGTGCCACCCATGCAGG + Intronic
1152805963 17:82356492-82356514 AGAGCTTGTGCACCCCAGGATGG + Intergenic
1153712952 18:7818832-7818854 ACAGCTCCTGCTGTCCATGGAGG + Intronic
1155583984 18:27343754-27343776 TCAGCCTGAGCTCCCCAGGGTGG + Intergenic
1160009786 18:75097909-75097931 ACAGCTTCTGCTCTCTAGGGAGG - Intergenic
1161573272 19:5041722-5041744 ACAGCCTGGGCTCTCCATGAGGG + Intronic
925729255 2:6905470-6905492 ACAGCAGGTGCAGCCCATGGAGG - Intergenic
925963955 2:9045429-9045451 ACAGCATGTGCACCCCTTGCTGG + Intergenic
928195901 2:29216237-29216259 GCTGCAGGTGCTCCCCATGGTGG + Intronic
928500376 2:31886891-31886913 AAAGCTTGTGCTGCCCCTAGGGG - Intronic
932347382 2:71004537-71004559 GCAGCTTGTGAGCCCCGTGGTGG + Intergenic
934756844 2:96830255-96830277 ACAGCTTGTCTTCCTCGTGGTGG - Intronic
938341737 2:130540504-130540526 ACTGCCTGTGGTCCCCAGGGTGG + Intronic
938348092 2:130580205-130580227 ACTGCCTGTGGTCCCCAGGGTGG - Intronic
1169933015 20:10854022-10854044 ACAGCCTGGGCTCCCCATCCAGG - Intergenic
1170230468 20:14041645-14041667 ACAGCTTGTACTACACATAGGGG + Intronic
1171036847 20:21719798-21719820 ACAATATGTGCTCCCCCTGGTGG - Intergenic
1171277355 20:23869326-23869348 ACAATTTGTGCTTCACATGGGGG + Intergenic
1174400405 20:50272911-50272933 ACAGCCTGTCATCCCCAGGGAGG + Intergenic
1174445901 20:50590892-50590914 GCAGCCTCTGCTTCCCATGGAGG + Intronic
1175941945 20:62541462-62541484 AGAGCTTCTGCTCTCCAGGGTGG - Intergenic
1178192909 21:30306733-30306755 AAAGCTTGTGCTCTCTCTGGAGG - Intergenic
1179976258 21:44868993-44869015 ACAGCATGTGCCTCCCACGGAGG + Intronic
1180090817 21:45533117-45533139 ACAGCCTGTGCTCCCCCTCCTGG - Intronic
1182149204 22:28016864-28016886 ACATCTTGTGCTCCTCAGGGAGG - Intronic
1183092739 22:35534249-35534271 AATGCTTGTGATCCCCATGGAGG - Intergenic
1184033728 22:41909104-41909126 ACATCTGGTGCTCCGGATGGGGG - Intergenic
1184375500 22:44109617-44109639 ACAGCTTTTGCTTCCCAGAGAGG + Intronic
1184785946 22:46672103-46672125 ACAGCTTTTGCTGCCCAGGGGGG + Intronic
1185044657 22:48522986-48523008 GCAGCTGGAGCCCCCCATGGCGG + Intronic
1185327353 22:50233432-50233454 GCAGCTGGAGCTCCCCTTGGTGG + Exonic
950535912 3:13577981-13578003 AGGGCTTGTGGTTCCCATGGGGG + Intronic
951439566 3:22707370-22707392 ACAGTTGGTGCAGCCCATGGAGG - Intergenic
954995269 3:54875498-54875520 ATAGCTCGTGCTCCTAATGGTGG - Intronic
955647824 3:61159371-61159393 GCAGCTTGTGCACCCTATTGTGG - Intronic
957715108 3:83917986-83918008 ACAATTTGTGCTCTCCAGGGTGG + Intergenic
958618436 3:96526792-96526814 ACAGCAGGTGCAGCCCATGGAGG + Intergenic
960620674 3:119633713-119633735 ACATCTTGTGCTCCAGATGTTGG - Intergenic
960655884 3:120003898-120003920 ACAGCAGGTGCAGCCCATGGAGG + Intronic
965001474 3:162959679-162959701 GCAGATTGTCCTCCCCATTGTGG + Intergenic
966686862 3:182705115-182705137 ACACCTGGTGCTCCCCAAGTGGG - Intergenic
969718365 4:8879304-8879326 ACAGCTTCTGATCCACATGAAGG - Intergenic
974115299 4:57571417-57571439 ACAGTGGGTGCTGCCCATGGAGG - Intergenic
975219493 4:71797661-71797683 ACAGTGGGTGCTGCCCATGGAGG - Intronic
976159529 4:82184241-82184263 ACAGCGGGTGCAGCCCATGGAGG + Intergenic
980760713 4:137230221-137230243 AGAACTTATGCTCCCCAAGGAGG + Intergenic
981296577 4:143140193-143140215 ACAGTTGGTGCAGCCCATGGAGG + Intergenic
981488426 4:145313502-145313524 ACAGCTTTTTCACCCAATGGTGG + Intergenic
982249329 4:153388775-153388797 ACAGCTTGTACTGCCATTGGCGG + Intronic
985227748 4:187780967-187780989 ACAACTTGTGATCCCCAGGCTGG + Intergenic
985588550 5:753188-753210 TCAGCTGGGCCTCCCCATGGGGG + Intronic
985603217 5:845627-845649 TCAGCTGGGCCTCCCCATGGGGG + Intronic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
989214827 5:38892933-38892955 AGTGCTTGTGCTCACCATTGGGG + Intronic
991438686 5:66622945-66622967 GCAGCTTGTGCTGTCCGTGGTGG + Intronic
992388015 5:76304441-76304463 ATAGCTTCATCTCCCCATGGAGG + Intronic
992877616 5:81073300-81073322 CCAGATTGTGTTCACCATGGTGG + Exonic
994187369 5:96830207-96830229 CCAGCTTGTGGTCCCCAAGCTGG + Intronic
994859666 5:105172704-105172726 GCAGATTGTCCTCCCCATTGTGG - Intergenic
995395041 5:111678476-111678498 CCAGCTTGTGCTCACCGTGTTGG + Intronic
997435318 5:133869897-133869919 ACAGGTTGTATTCCCCATGTTGG + Intergenic
998561730 5:143178642-143178664 ACAGCTGCTGCTGCCCATGGGGG + Intronic
1002382897 5:178842885-178842907 ACAGCAAGTCCTCCCCAAGGAGG + Intergenic
1003542108 6:7026987-7027009 ACAGCGTGTGCAGCCCACGGAGG + Intergenic
1003969000 6:11280478-11280500 ACACCCAGTCCTCCCCATGGTGG - Intronic
1005815312 6:29547272-29547294 ACAGCGGGTGCAGCCCATGGAGG + Intergenic
1009491437 6:64297100-64297122 ACAGCTTGTGACGGCCATGGTGG + Intronic
1010034944 6:71314040-71314062 AAAGCTAGTGGTGCCCATGGTGG + Intergenic
1011302729 6:85892956-85892978 ACAGTGAGTGCACCCCATGGAGG - Intergenic
1013933794 6:115569189-115569211 ATAGCTTGTGCTTAGCATGGTGG - Intergenic
1015117242 6:129663168-129663190 ACAGCTTGTGTTACCCTTGCTGG - Intronic
1015269808 6:131326564-131326586 ACAGCTTGGGCACCACAGGGTGG - Intergenic
1015830772 6:137366243-137366265 ACAGCTTGTTGTCCCCCAGGCGG - Intergenic
1015989202 6:138918381-138918403 ACAGATTTTGGTACCCATGGGGG + Intronic
1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG + Intronic
1017776489 6:157684890-157684912 ACTGCTTATCCTCCCCATCGTGG - Intergenic
1018220078 6:161569275-161569297 ACAGTTTGGGCTCCCCAGGGAGG - Intronic
1021307135 7:19045865-19045887 ACAGCGGGTGCAACCCATGGAGG + Intronic
1023833853 7:44057212-44057234 ACATCTTGGGCTGCCCCTGGAGG + Intronic
1034267462 7:149788215-149788237 ACACCCTGTGCCCTCCATGGTGG + Intergenic
1034892199 7:154851492-154851514 TCTACTTGAGCTCCCCATGGGGG + Intronic
1035944778 8:3949894-3949916 ACACCTGGAGCTTCCCATGGAGG - Intronic
1040979897 8:53236175-53236197 ACAGCTCTTGCTCCTCTTGGAGG + Intronic
1041168687 8:55117884-55117906 ACAGCTGGTGGTCACCCTGGTGG - Intronic
1041172689 8:55161118-55161140 ACAGGAAGTGCTTCCCATGGTGG + Intronic
1041274141 8:56140687-56140709 ACAGATTGTCCTCCCAATCGTGG - Intergenic
1041716352 8:60935868-60935890 GCAGGTTGTCCTCCCCATTGTGG + Intergenic
1047473486 8:125202206-125202228 ACAGCTGGTGCAGCCCATGGAGG - Intronic
1047693907 8:127384260-127384282 AAAGCAAGTGCCCCCCATGGTGG + Intergenic
1048923603 8:139251935-139251957 ACAGCTTGTGATCCACACGGTGG + Intergenic
1049280553 8:141741942-141741964 ACAGCCTGGGCTCACCATGGAGG - Intergenic
1049928021 9:428667-428689 ACTGCTTTTCCTCTCCATGGTGG - Intronic
1050118685 9:2286668-2286690 ACAGCCTGTGCTCCACAGGATGG - Intergenic
1051035083 9:12734694-12734716 ACAGGATGTGCTCCCTCTGGAGG - Intergenic
1052389855 9:27866943-27866965 CCTGCTTTTGCTCCCCCTGGGGG - Intergenic
1053820361 9:41960283-41960305 ACTGCTTGGGCTGCGCATGGTGG - Intronic
1054110633 9:61103969-61103991 ACTGCTTGGGCTGCGCATGGTGG - Intergenic
1054610224 9:67227156-67227178 ACTGCTTGGGCTGCGCATGGTGG + Intergenic
1057471515 9:95361074-95361096 CCAGCCTGCGCTCCCCAGGGTGG + Intergenic
1060287024 9:122262870-122262892 ACAGTTTGTGCTGGGCATGGTGG - Intronic
1062634698 9:137484710-137484732 CCAGCTTGGGCTCCCCACGGAGG - Exonic
1186835888 X:13437433-13437455 ACAGATTGCCCTCCCCGTGGGGG - Intergenic
1189280542 X:39817690-39817712 ACAGCTAGTGCTACCCCTGTAGG - Intergenic
1193871116 X:86799514-86799536 ACAGTGGGTGCTGCCCATGGAGG + Intronic
1196872471 X:120125810-120125832 ACAGCTTGTCATACCCATAGGGG - Intergenic
1200233743 X:154458560-154458582 ACTCCTTGTGCCCCGCATGGTGG + Intronic