ID: 1016322080

View in Genome Browser
Species Human (GRCh38)
Location 6:142857431-142857453
Sequence CATTATGGCCGGATGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016322080_1016322086 17 Left 1016322080 6:142857431-142857453 CCAAGCACCATCCGGCCATAATG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1016322086 6:142857471-142857493 AATTATGCCTGCCTGTCTATAGG 0: 1
1: 0
2: 1
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016322080 Original CRISPR CATTATGGCCGGATGGTGCT TGG (reversed) Intronic
900846744 1:5109808-5109830 CATTGTGGCCGAGTCGTGCTGGG - Intergenic
901224685 1:7606300-7606322 CATCATGGCCGGCAGCTGCTGGG - Intronic
909569514 1:77092885-77092907 CACCATGGCAGGTTGGTGCTGGG - Intronic
1069398562 10:68017016-68017038 CATCATAGCCTGATGGTGGTTGG + Intronic
1071100978 10:82037318-82037340 CATTCTGCCCTGATGGAGCTGGG - Intronic
1080586219 11:33685319-33685341 CATCATGGCCGGATGATGAAGGG - Intergenic
1080898367 11:36464271-36464293 CAATATGGCAAGAGGGTGCTGGG + Exonic
1085042847 11:73336777-73336799 CAGTGTGGTCGGATAGTGCTGGG + Intronic
1085919960 11:80942036-80942058 CATTCTGACAGGATTGTGCTTGG - Intergenic
1086937375 11:92759593-92759615 CCTTATGGCCTGAGGGAGCTGGG + Intronic
1095586754 12:43858332-43858354 CCTTAGGACCGGATTGTGCTAGG + Intronic
1097455691 12:59796183-59796205 CATTATTCCCCGCTGGTGCTGGG + Intergenic
1116962603 14:50981998-50982020 TATGATGACCGGGTGGTGCTAGG - Exonic
1117392682 14:55277244-55277266 CATTAGGGTCGCATTGTGCTTGG + Intronic
1138448404 16:57078757-57078779 CACCATGGCTGGCTGGTGCTGGG + Intronic
1140188558 16:72795481-72795503 TATTATTGGCTGATGGTGCTGGG + Exonic
1142053235 16:87974425-87974447 CATGGTGGCAGGATGCTGCTCGG + Intronic
1142314471 16:89334910-89334932 CATGAGGGCCCCATGGTGCTGGG + Intronic
1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG + Exonic
1156102414 18:33613200-33613222 CATCATGGCCAGATGGTTCTGGG + Intronic
1159422961 18:68247161-68247183 CATTATACCCTGAGGGTGCTGGG - Intergenic
1165456046 19:35911319-35911341 CCGTATGACTGGATGGTGCTTGG - Intergenic
929666738 2:43839203-43839225 CTTGATGTCCGGGTGGTGCTAGG - Intronic
932912726 2:75821738-75821760 CATTCTTGCCAGATGGGGCTTGG + Intergenic
940063199 2:149595889-149595911 CATTATGTCCTGATGTTACTGGG + Intergenic
944315512 2:198281248-198281270 AATTATGGCCAGTGGGTGCTGGG - Intronic
946346119 2:219111869-219111891 CATCATGGCAGGATGGGGCGAGG + Intronic
1171379742 20:24725286-24725308 AATGATGGCGGGATGGTGTTTGG + Intergenic
1172232668 20:33347663-33347685 CATTGTGGCCTGATGGTCCCTGG + Intergenic
1173859067 20:46270226-46270248 CATTCTGACCTGATGGTGCTGGG + Intronic
1179268989 21:39833974-39833996 CATTATGGCTGATAGGTGCTGGG - Intergenic
1182357361 22:29728322-29728344 CAGGATGGCCGCAGGGTGCTGGG + Intronic
1182597783 22:31435450-31435472 CAATATGGACGGAGGGGGCTGGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
952053638 3:29416717-29416739 CATTGTGGCAGGAACGTGCTGGG + Intronic
952185608 3:30964958-30964980 GATTATTGCTGTATGGTGCTGGG + Intergenic
963415866 3:144994886-144994908 CAAGATGGCTGAATGGTGCTGGG - Intergenic
970232773 4:13927962-13927984 CTCTATGCCAGGATGGTGCTAGG + Intergenic
971597057 4:28543521-28543543 CATTATTTCTGGATGGGGCTGGG + Intergenic
981228652 4:142326666-142326688 CATTAGACCCGGATGGTGATAGG + Intronic
982384132 4:154781621-154781643 CCTTCTGGCCGGATGCTGCCGGG - Intronic
986534974 5:8777341-8777363 CATTTAGGCAGGATGGAGCTGGG + Intergenic
989505314 5:42219896-42219918 CAGTATTGCCAGATAGTGCTGGG - Intergenic
997830781 5:137147948-137147970 CATTAAGGCTTTATGGTGCTGGG - Intronic
1005694267 6:28336375-28336397 CATTAGAGCCGGAAGGTGTTAGG + Intronic
1012696196 6:102387243-102387265 CATTATGGCCTGATGGATTTTGG - Intergenic
1016322080 6:142857431-142857453 CATTATGGCCGGATGGTGCTTGG - Intronic
1018588095 6:165385320-165385342 CAGTATGCCCGAATTGTGCTTGG - Intronic
1024282054 7:47726494-47726516 CATTCTGGCTGGAGGGTGCAGGG + Intronic
1024539524 7:50464720-50464742 CATTATGGCCAGAACTTGCTTGG - Intronic
1051080197 9:13285226-13285248 CATTCTAGCTGGATGGTGGTAGG - Intergenic
1053004186 9:34593360-34593382 TACTATCTCCGGATGGTGCTGGG - Intergenic
1196037209 X:111158641-111158663 CAATATGGCAGGATAGTGTTTGG + Intronic
1199859125 X:151783936-151783958 CAGTATGGCTGGATAGTGCATGG + Intergenic