ID: 1016322669

View in Genome Browser
Species Human (GRCh38)
Location 6:142864074-142864096
Sequence AAGCAGCCAAGCCAGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016322662_1016322669 3 Left 1016322662 6:142864048-142864070 CCCTACCATTGGAAAGACCACCC 0: 1
1: 0
2: 2
3: 13
4: 75
Right 1016322669 6:142864074-142864096 AAGCAGCCAAGCCAGCAAGAGGG No data
1016322661_1016322669 4 Left 1016322661 6:142864047-142864069 CCCCTACCATTGGAAAGACCACC 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1016322669 6:142864074-142864096 AAGCAGCCAAGCCAGCAAGAGGG No data
1016322663_1016322669 2 Left 1016322663 6:142864049-142864071 CCTACCATTGGAAAGACCACCCA No data
Right 1016322669 6:142864074-142864096 AAGCAGCCAAGCCAGCAAGAGGG No data
1016322664_1016322669 -2 Left 1016322664 6:142864053-142864075 CCATTGGAAAGACCACCCAGTAA No data
Right 1016322669 6:142864074-142864096 AAGCAGCCAAGCCAGCAAGAGGG No data
1016322660_1016322669 10 Left 1016322660 6:142864041-142864063 CCTTTGCCCCTACCATTGGAAAG 0: 1
1: 0
2: 1
3: 11
4: 139
Right 1016322669 6:142864074-142864096 AAGCAGCCAAGCCAGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016322669 Original CRISPR AAGCAGCCAAGCCAGCAAGA GGG Intronic