ID: 1016323104

View in Genome Browser
Species Human (GRCh38)
Location 6:142869794-142869816
Sequence CTGTGTTAATAAAATGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 489}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016323104_1016323110 4 Left 1016323104 6:142869794-142869816 CCAACTTCATTTTATTAACACAG 0: 1
1: 0
2: 3
3: 39
4: 489
Right 1016323110 6:142869821-142869843 CCAAAAAGGCTTGGGTTGAAAGG No data
1016323104_1016323106 -5 Left 1016323104 6:142869794-142869816 CCAACTTCATTTTATTAACACAG 0: 1
1: 0
2: 3
3: 39
4: 489
Right 1016323106 6:142869812-142869834 CACAGTGACCCAAAAAGGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 178
1016323104_1016323107 -4 Left 1016323104 6:142869794-142869816 CCAACTTCATTTTATTAACACAG 0: 1
1: 0
2: 3
3: 39
4: 489
Right 1016323107 6:142869813-142869835 ACAGTGACCCAAAAAGGCTTGGG 0: 1
1: 0
2: 1
3: 9
4: 143
1016323104_1016323105 -10 Left 1016323104 6:142869794-142869816 CCAACTTCATTTTATTAACACAG 0: 1
1: 0
2: 3
3: 39
4: 489
Right 1016323105 6:142869807-142869829 ATTAACACAGTGACCCAAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 212
1016323104_1016323111 5 Left 1016323104 6:142869794-142869816 CCAACTTCATTTTATTAACACAG 0: 1
1: 0
2: 3
3: 39
4: 489
Right 1016323111 6:142869822-142869844 CAAAAAGGCTTGGGTTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016323104 Original CRISPR CTGTGTTAATAAAATGAAGT TGG (reversed) Intronic
900546746 1:3233652-3233674 CTGTGTTAGTAAAGTTATGTAGG - Intronic
901339732 1:8485403-8485425 CTGTTTTAATTTAATGAAGATGG - Intronic
902436571 1:16401805-16401827 GTGAGTTAAGAAAATCAAGTGGG - Intronic
902934702 1:19756529-19756551 CTGTATTTATAATATGAAATTGG + Intronic
903812901 1:26044964-26044986 TTGGGCTAATTAAATGAAGTTGG - Intronic
906014350 1:42561092-42561114 CTGGCTTAATAAAATGAGTTAGG - Intronic
906622238 1:47291864-47291886 CTGTCTTAAAAAAATAAAATAGG - Intronic
907349496 1:53815088-53815110 CTGGCTTCATAAAATGAATTAGG - Intronic
907379895 1:54078271-54078293 CCCTGTTTATAAACTGAAGTAGG - Intronic
909518346 1:76538005-76538027 CTGGCTTCATAAAATGAATTAGG - Intronic
910011945 1:82475216-82475238 ATGTGTTGATATTATGAAGTAGG - Intergenic
910050776 1:82971741-82971763 CTTTCTAAATAAAATGAAGCAGG - Intergenic
910582144 1:88840305-88840327 CTGATTTCATAAAATGAATTGGG - Intergenic
910598078 1:89000997-89001019 CTGTGCTCATAGAATGAATTGGG + Intergenic
910772425 1:90843586-90843608 CTGTATTAATAATAGGAAGGGGG + Intergenic
912055481 1:105592937-105592959 CAGTTTTAGTAAACTGAAGTGGG - Intergenic
912583817 1:110743577-110743599 CTGTACTAATATAAGGAAGTGGG + Intergenic
913118257 1:115716402-115716424 CTGTGCTTAGGAAATGAAGTAGG - Intronic
914906006 1:151745097-151745119 CTGGCTTCATAAAATGAAGTAGG + Intergenic
915338220 1:155160525-155160547 CTGTTTCAGTAAAATGAAATGGG - Intergenic
915365235 1:155311480-155311502 TTGTTTTAATATAATGAAGGAGG + Intronic
915378012 1:155415039-155415061 CTGTGTAACTAAAATGATATTGG - Intronic
915966020 1:160308904-160308926 CTGGGGTAATAAAATGGAGGAGG + Intronic
916320259 1:163497865-163497887 ATGTGTGCATAAAATGAATTGGG + Intergenic
917128874 1:171718831-171718853 CTGAGAAAATAAAATGAATTAGG + Intronic
917600132 1:176565689-176565711 CTGTCTCAATAAAATAAAATGGG + Intronic
917714376 1:177719429-177719451 CTGGGGTCATAAAATGAATTAGG + Intergenic
917776511 1:178341891-178341913 TTCTGTTAATAATATGAAATGGG + Intronic
918762629 1:188432643-188432665 ATGTGTAAATAAGATCAAGTAGG - Intergenic
918831794 1:189407662-189407684 CTTTGTTGAAAAAATGAAATTGG + Intergenic
919311277 1:195912960-195912982 ATGTGTTAGTAAAATTAATTGGG + Intergenic
919599958 1:199610417-199610439 CTGAGTGAATAAAAGGAGGTAGG - Intergenic
919643642 1:200069757-200069779 CTGGGTAAATAAAATCAAATAGG - Intronic
920914719 1:210250983-210251005 CTGTCTTCATAAAAAGAAGGGGG - Intergenic
922138154 1:222853127-222853149 CTGTGTTTTAATAATGAAGTTGG + Intergenic
922280200 1:224115905-224115927 CTATTTTAAAAAAATGTAGTGGG + Intronic
922427752 1:225515374-225515396 CTGTATTAAAAACATGAAGGAGG + Intronic
922428618 1:225524364-225524386 CAATTTTAACAAAATGAAGTAGG + Intronic
923966164 1:239141290-239141312 AAGTCTTAATAAAAGGAAGTAGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062995958 10:1867395-1867417 CTTTATAAATAAAATGAAGTAGG - Intergenic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1064256629 10:13747925-13747947 CCCTGTTAATAAAAAGCAGTGGG + Intronic
1064737278 10:18395379-18395401 CTGAGATAATAAAATGATGGTGG - Intronic
1064824757 10:19385254-19385276 TTGAGGTAATAAAATGAATTAGG + Intronic
1064828673 10:19436363-19436385 CTGTGGTAATAGACTGTAGTTGG - Intronic
1064907838 10:20366996-20367018 CTGTCTTCATAGAATGAATTAGG + Intergenic
1065424945 10:25591240-25591262 CTGGTTAAATAAAATTAAGTAGG - Intronic
1066162864 10:32753022-32753044 CTAGCTTAATAAAATGAAGAAGG + Intronic
1067724311 10:48756937-48756959 CTGGCTTTATAAAATGAATTGGG + Intronic
1068228028 10:54132406-54132428 CTATGGCCATAAAATGAAGTGGG + Intronic
1068608451 10:59032140-59032162 CTAAATTAATAAAATAAAGTGGG + Intergenic
1069103873 10:64358722-64358744 TTTTGTAAATCAAATGAAGTGGG + Intergenic
1069671782 10:70211926-70211948 CTGTGTTAATTCATTGAAGAAGG - Intronic
1070406014 10:76096069-76096091 CACTGTTAATAAAATGAAAAAGG - Intronic
1071055182 10:81501913-81501935 AAGTGTAAAAAAAATGAAGTGGG - Intergenic
1071176884 10:82937226-82937248 CAGTGTTAATAAAATATAATTGG - Intronic
1075660319 10:124190090-124190112 CTGGCTTCATAAAATGAATTAGG + Intergenic
1076088335 10:127656253-127656275 CTGGGTGATTAAAATGAAGAAGG - Intergenic
1076739356 10:132475122-132475144 CTAGGTTCATAAAATTAAGTGGG + Intergenic
1077389357 11:2292504-2292526 CTCTGTGAATATACTGAAGTAGG - Intergenic
1078360681 11:10665353-10665375 GTGTATTAGTAAAAAGAAGTGGG - Intronic
1079702553 11:23566841-23566863 CTGTGTTAAAAAAAAAAAGTTGG - Intergenic
1080360573 11:31508897-31508919 CAGGGTTCATAAAATAAAGTAGG + Intronic
1080567372 11:33523988-33524010 CTGGTTTCATAAAATGAATTGGG + Intergenic
1080742571 11:35079983-35080005 CTGTTTTATTCAAATGCAGTGGG - Intergenic
1080926315 11:36760181-36760203 CTGAGGTAATAACATGAAGGTGG + Intergenic
1081021513 11:37954245-37954267 ATGTGTTTATAAAATGAATATGG + Intergenic
1081078145 11:38701815-38701837 TTGTCTTTATAAAATGAAGGTGG - Intergenic
1081300285 11:41443130-41443152 CAGTGTTAATATGATGAGGTTGG - Intronic
1082203640 11:49404706-49404728 CTGTTTTATTAAAATAAAGAAGG + Intergenic
1082760233 11:57120273-57120295 CTGTCATAATAAAATGCTGTAGG - Intergenic
1083515899 11:63258325-63258347 CTGTCCTCATAAAATGAATTAGG + Intronic
1083693020 11:64422883-64422905 CTGTTTTAGTAAAATGAGATAGG - Intergenic
1083792713 11:64996259-64996281 CTGTCTCAATAAAATAAAATAGG - Intronic
1085483274 11:76840373-76840395 TTGTTGTAATAAAATTAAGTAGG + Intergenic
1085552793 11:77390499-77390521 CTGTCTTAAAAAAATAAAATAGG - Intronic
1085649454 11:78254388-78254410 GTCTGTTAAGAAGATGAAGTAGG + Intronic
1085830139 11:79891398-79891420 GTGTGTAAATAAAATGGTGTTGG + Intergenic
1086041469 11:82484578-82484600 AAGTGATAATAAAATGAAATGGG + Intergenic
1086220021 11:84431163-84431185 CTATGTTTATAAAATCATGTAGG - Intronic
1086516065 11:87614810-87614832 TTGTGATAATAAAATAAATTGGG - Intergenic
1086651448 11:89295726-89295748 CTGTTTTATTAAAATAAAGAAGG - Exonic
1088608619 11:111555904-111555926 CTGTGTCCATAAAATGAAATAGG + Intronic
1088983503 11:114885544-114885566 TTGTGTTAATAATTTGAAATTGG - Intergenic
1089004812 11:115082485-115082507 CTGTATTAATAAAAGGGTGTGGG + Intergenic
1089107678 11:116027275-116027297 CTGGCTTCATAAAATGAATTAGG - Intergenic
1089428151 11:118397920-118397942 CTGTGCTTATAAAATGAAAAAGG + Exonic
1089485262 11:118840780-118840802 CTGTGTCAACAAAATGATGATGG - Intergenic
1090565558 11:127988320-127988342 CTTTGTTATTATAATGAAGGTGG + Intergenic
1091314378 11:134601556-134601578 CTATCTTAATAAACTTAAGTAGG + Intergenic
1092383840 12:8020155-8020177 CTGTCTTTATAAAATAAAATAGG + Intergenic
1092784109 12:12012349-12012371 GTATAATAATAAAATGAAGTGGG - Intergenic
1093212272 12:16322136-16322158 TTGTGTTAATAAATTGCAGTAGG - Intergenic
1093671952 12:21886979-21887001 CTGTGTGAAGAAAATGAAAGAGG - Intronic
1094055018 12:26260101-26260123 CTGTCTTCATAAAATGAGTTAGG - Intronic
1095559473 12:43549271-43549293 ATATGTTAATAAAATGAACTAGG + Intronic
1095770386 12:45948351-45948373 AGGTATTAAAAAAATGAAGTGGG - Intronic
1095893228 12:47254337-47254359 CTGCCTTCATAAAATGAATTAGG - Intergenic
1099042250 12:77670425-77670447 CTGGCTTCATAAAATGATGTAGG - Intergenic
1099677405 12:85779420-85779442 CTTGGATAATAAAATGAATTAGG - Intergenic
1099792947 12:87360213-87360235 CTGGCTTCATAAAATGAATTAGG + Intergenic
1100068347 12:90679575-90679597 CTTTGTTAATGAAATGAAAAAGG + Intergenic
1100841529 12:98617549-98617571 ATCAGTTAATAAAATGAAGAAGG + Intronic
1100956300 12:99912651-99912673 CAGTGTTAAAAAAATTAACTGGG - Intronic
1101756385 12:107623841-107623863 CAGTGTTTACAAAATGAAATGGG + Intronic
1102850208 12:116235679-116235701 CTGAGTTAACAAAAAGGAGTAGG - Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103025325 12:117569373-117569395 CTGTTTACATAAAAAGAAGTAGG + Intronic
1105064774 12:133186889-133186911 TTGTGTTACAAAAAAGAAGTGGG - Intronic
1105515516 13:21086592-21086614 CTGTCCTTATAAAATGAAATTGG - Intergenic
1105953855 13:25260778-25260800 CTATGTTAATAAAAAGAAGAAGG + Intronic
1105982396 13:25531948-25531970 CTTTATCAATAAAATGAAGTTGG + Intronic
1106225273 13:27781236-27781258 CTGTGAAAATAAAATAAATTAGG + Intergenic
1106523153 13:30516096-30516118 CTGTATTAAAAAAATTAAATGGG - Intronic
1107508002 13:41054839-41054861 ATGTTTTAATGAAATGAATTTGG - Intronic
1108624688 13:52216205-52216227 CTGGCCTCATAAAATGAAGTAGG - Intergenic
1109683040 13:65777910-65777932 TAGTGGTAATAAAATGAATTTGG + Intergenic
1109703559 13:66058937-66058959 CTTTGTTAATCAAATAAAATTGG - Intergenic
1109893046 13:68643810-68643832 GTGGGATAATAAAAAGAAGTAGG + Intergenic
1110945530 13:81410782-81410804 CTGTGTTCATACAGTGAATTAGG + Intergenic
1111043467 13:82783123-82783145 CTGTTTTAAACAAATGAGGTTGG - Intergenic
1111165467 13:84452320-84452342 CTGGCTTCATAAAATGAATTAGG + Intergenic
1111763969 13:92502576-92502598 CTGTGTTAATTAGATGAAGTGGG + Intronic
1111923788 13:94441225-94441247 GTGTTTTAAGAAGATGAAGTTGG - Intronic
1112182710 13:97100653-97100675 CTGACTTAATAAAATAAATTGGG + Intergenic
1112526723 13:100155967-100155989 GAGTGTTGATAAAATGAAGTTGG + Intronic
1112970597 13:105257288-105257310 CTGCGTTGATAAAATGAGGAGGG + Intergenic
1113001928 13:105649376-105649398 GTGTATTATTAAAATTAAGTTGG + Intergenic
1115014404 14:28592610-28592632 TTTTGTTAATAAAATGCATTTGG - Intergenic
1115094991 14:29623793-29623815 CTGTGATAATAACATGAATTGGG - Intronic
1115576792 14:34719117-34719139 CTGAGTTAATAAGTTGAAGCTGG - Intergenic
1115894859 14:38075117-38075139 TTGTTTTAATGAAATGAATTGGG + Intergenic
1116223623 14:42119335-42119357 CTGGCTTCATAAAATGAATTAGG - Intergenic
1116492706 14:45525234-45525256 CTGCCTTCATAAAATGAATTTGG + Intergenic
1116744210 14:48796102-48796124 CTGGCTTCATAAAATGAATTAGG - Intergenic
1117419126 14:55526144-55526166 CTTTGTTCTTAAAATGAAGAAGG + Intergenic
1117559875 14:56926310-56926332 TTTTTTTAATAAAATGAATTTGG + Intergenic
1117829879 14:59739766-59739788 CTGAGTGAATAAAATGAACAGGG + Intronic
1121143236 14:91560222-91560244 CTGGCCTAATAAAATGAATTAGG - Intergenic
1122040328 14:98983317-98983339 CCATGTTCATAAAATGAAGAGGG - Intergenic
1123503725 15:20916448-20916470 CAGTCTTAAAAAAATGATGTAGG + Intergenic
1123560970 15:21490120-21490142 CAGTCTTAAAAAAATGATGTAGG + Intergenic
1123597212 15:21927413-21927435 CAGTCTTAAAAAAATGATGTAGG + Intergenic
1124810483 15:32932504-32932526 CTGTTCTCATAAAATGAATTTGG + Intronic
1125292905 15:38169276-38169298 CTGACTTAATAAAATGAAAGAGG + Intergenic
1125884818 15:43220733-43220755 CTGTTTTCATTAAAGGAAGTGGG - Exonic
1126920447 15:53516340-53516362 CTGTGTAATTGAAATGACGTGGG - Exonic
1127101834 15:55573825-55573847 CTGTGTTCTTACAATAAAGTAGG + Intronic
1127560163 15:60128281-60128303 CAGTGTTAAGAACATGAACTTGG + Intergenic
1127712727 15:61616571-61616593 CTGGCTTCATAAAATGAATTTGG - Intergenic
1128415359 15:67440354-67440376 CTGACTTCATAAAATGAATTAGG - Intronic
1128683026 15:69665218-69665240 GTGTGTTAGTAAAATGATGTCGG - Intergenic
1130515605 15:84623736-84623758 CTGTGTTAAAAACCTGAACTAGG + Intronic
1130635698 15:85617693-85617715 CTGTGTTCAAAAAAAGAAGAAGG + Intronic
1130826693 15:87555364-87555386 CTATGTTATTGAAATTAAGTTGG - Intergenic
1131535700 15:93235876-93235898 TTGTTTCAATAAAATGAAATTGG - Intergenic
1132054856 15:98643032-98643054 CTGTATTAATAAAACAAATTAGG + Intergenic
1132375550 15:101326099-101326121 CTGTGTTGTTAAAGAGAAGTGGG - Intronic
1202969317 15_KI270727v1_random:217286-217308 CAGTCTTAAAAAAATGATGTAGG + Intergenic
1134011023 16:10853216-10853238 CAGAGTGAATAGAATGAAGTAGG + Intergenic
1136493254 16:30624752-30624774 CTGTCTTAAAAAAAAGAAATGGG - Intergenic
1138807997 16:60114420-60114442 CTGTCTTTACAAAATGAAATTGG + Intergenic
1140095642 16:71873461-71873483 GTCTGTTAATGAAGTGAAGTGGG + Intronic
1141116895 16:81316185-81316207 CTGTTTTAATAAAAGGAAAGGGG + Intronic
1141489967 16:84366238-84366260 CTGTGATTTTAAAATGATGTTGG - Intergenic
1141541863 16:84729784-84729806 CAGTGTTAAGGAAATTAAGTTGG + Intronic
1141584240 16:85022516-85022538 CTGTCTTAATAATAAGAAGAAGG + Intergenic
1142840860 17:2628593-2628615 CTGGCTTCATAAAATGAATTAGG + Intronic
1142895889 17:2978631-2978653 CTGTATTAATAAATTGACTTCGG + Intronic
1143752522 17:9039305-9039327 CAGTGTTGTTAAAATGAACTTGG + Intronic
1144163816 17:12587760-12587782 CTGTGGAAAAAAAATAAAGTAGG - Intergenic
1144465738 17:15495704-15495726 CTGTGTTAAAATAATTAATTGGG + Intronic
1145796711 17:27659780-27659802 CTGTGTCAAAAAAAAAAAGTTGG + Intergenic
1147419528 17:40315464-40315486 CTGTGAGAATCAAATGGAGTGGG + Intronic
1149526750 17:57362158-57362180 CTTTGTAAACAAAATGAGGTTGG + Intronic
1150169871 17:62982167-62982189 CTGTGGTAATAAAATGATGCAGG - Intergenic
1150177834 17:63080543-63080565 ATGTATTAATCAAATAAAGTTGG - Intronic
1150537992 17:66064324-66064346 TTATGTTACTAAAATGAAATAGG + Intronic
1151958281 17:77391652-77391674 CTGGGTTTATTAAATGTAGTGGG - Intronic
1152936316 17:83139433-83139455 CTGTATTCATAAAATAAAGTGGG - Intergenic
1153262052 18:3233889-3233911 CTGTGTTAATAATTTGGAGTGGG - Intergenic
1153469049 18:5422521-5422543 CTGTGCAAATAAAAAGAATTAGG - Intronic
1154222999 18:12473484-12473506 CTGAGTAAATAAAATACAGTAGG + Intronic
1154927636 18:20953283-20953305 CTGCATTAAAAAAATTAAGTTGG + Intronic
1155514355 18:26609339-26609361 CTGTGATATTAAAATGAATTCGG + Intronic
1156247306 18:35313612-35313634 CTGGCTTCATAAAATGAATTTGG - Intergenic
1156369732 18:36461939-36461961 CTTTTTCAATAAAATTAAGTTGG + Intronic
1157422337 18:47557484-47557506 CTGTTTTAAAAAAATGAATAGGG - Intergenic
1157745941 18:50135654-50135676 GTGTATTACTTAAATGAAGTGGG + Intronic
1158793802 18:60816382-60816404 CTGTCTTCATAAAATGCATTAGG + Intergenic
1159211006 18:65321852-65321874 CAGTGTTATAAAAATAAAGTAGG + Intergenic
1159274472 18:66198035-66198057 ATGTGTTAATTAAATTAATTGGG - Intergenic
1159342119 18:67148306-67148328 CTGTGTTAATATTGTGAAATTGG + Intergenic
1159987979 18:74867848-74867870 CTGTGATAATAAGTTGAATTGGG + Intronic
1160132623 18:76241674-76241696 CTGACTTCACAAAATGAAGTGGG - Intergenic
1160267322 18:77350752-77350774 CTGGCTTCATAAAATGAATTTGG + Intergenic
1161522788 19:4734747-4734769 CTGTCTCAAAAAAATAAAGTGGG + Intergenic
1161593607 19:5140189-5140211 CTGTGTGGATCAAATGCAGTAGG - Intronic
1162607273 19:11719310-11719332 TTTTGATAATAAAATAAAGTGGG + Intergenic
1164723452 19:30449636-30449658 CTCTGTTCATTAAATAAAGTCGG + Intronic
1165947766 19:39455257-39455279 GTGTGTTAAAAAAATTACGTGGG + Intronic
1168389869 19:55998111-55998133 CTCTTTTAATGAAATTAAGTAGG + Intergenic
924997062 2:371560-371582 CTGGGATCATAAAATGAATTTGG + Intergenic
925687634 2:6489784-6489806 CTTTTTTAATAAAATGAAATTGG - Intergenic
925802558 2:7615469-7615491 CTGTGTGAGTAAAATGCACTAGG + Intergenic
926606052 2:14899426-14899448 CTGGTTAAATAAAATGAAGAAGG + Intergenic
926844334 2:17118588-17118610 CTGTTCTCATAAAATGAATTAGG + Intergenic
927548590 2:23976919-23976941 TCATGTTAATAAAATGTAGTAGG - Intronic
927877350 2:26667216-26667238 CTGTGCTAATAAAATGGAGGTGG - Intergenic
928047113 2:27946496-27946518 CTGTGTTTATAAAATAAGTTGGG + Intronic
928469920 2:31564180-31564202 ATGTGTTCACAAAATTAAGTAGG + Intronic
928473237 2:31595690-31595712 CTGGCTTCATAAAATGATGTAGG - Intergenic
928856267 2:35806273-35806295 CTGGCTTCATAGAATGAAGTAGG - Intergenic
928886436 2:36154144-36154166 CTTTTTTAATATAAAGAAGTTGG - Intergenic
929661064 2:43785292-43785314 CTGTCTCAATAAAATAAAATAGG + Intronic
929816511 2:45237220-45237242 CTCTGATAATGAAACGAAGTAGG - Intergenic
930106181 2:47641797-47641819 CTCTGCGAAAAAAATGAAGTTGG - Intergenic
930433462 2:51311648-51311670 CTGGCTTTATAAAATGAATTGGG - Intergenic
930803788 2:55469875-55469897 CTGTATTAGTAGAATGAAATGGG + Intergenic
931034655 2:58226212-58226234 CTTGGGTAATAAAATGAACTTGG + Intronic
931368417 2:61639695-61639717 CTCTGTTAAGAAAATGACTTGGG - Intergenic
931503584 2:62898865-62898887 GTGTTTTAAAAAAATGAATTTGG + Intronic
931567909 2:63635357-63635379 CTGGCTTCATAAAATGAGGTTGG - Intronic
933049043 2:77578807-77578829 CTATGTTAATTAAATTAACTAGG + Intronic
935896537 2:107744119-107744141 CTGCCTTAATAAAATGGAGGTGG - Intergenic
935954308 2:108360371-108360393 CTGTCTTCATAGAATGAATTAGG - Intergenic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
937374306 2:121324924-121324946 CTGTGTCAAAAAAATAAAATTGG + Intergenic
937745697 2:125411005-125411027 ATTTGTTAATAAAATGAAATTGG + Intergenic
937874680 2:126813906-126813928 CTGTTTTCATAGAATCAAGTAGG + Intergenic
939217294 2:139255272-139255294 CTAGCTTAATAAAATGAATTTGG - Intergenic
939271585 2:139946462-139946484 CTGCTTTTATAAAATGAAGCTGG + Intergenic
939512298 2:143122500-143122522 CTTTGTTAATAATATAAATTTGG + Intronic
939537937 2:143455656-143455678 TTTTGTTAATAAAATCAAGCAGG - Intronic
939769859 2:146302007-146302029 CTGGCTTCATAAAATGAATTAGG - Intergenic
940256197 2:151732505-151732527 TTGGGTAAATATAATGAAGTTGG + Intronic
940373943 2:152935228-152935250 CTGGCTTTATAAAATGAATTGGG + Intergenic
940626070 2:156176740-156176762 CTGTATTAATAATATAAAATAGG - Intergenic
940674926 2:156715983-156716005 CTGTCTTCATAAAATGAGTTAGG + Intergenic
941845652 2:170129559-170129581 CTGGGTTCATAAAATGATGTAGG - Intergenic
943012515 2:182467540-182467562 CTGGCTTAATAAAATAAATTGGG - Intronic
943370434 2:187009638-187009660 CTGAACTAATAAAATGAAGAAGG - Intergenic
943847183 2:192666330-192666352 CTATGGTAGTAAAAAGAAGTAGG - Intergenic
944090362 2:195902957-195902979 CTTTGTTAAAAAAATTAAATTGG + Intronic
945075446 2:206034234-206034256 CTGGCTTCATAGAATGAAGTAGG - Intronic
945204221 2:207314614-207314636 TTGTGATAATTAAATGACGTCGG + Intergenic
945597084 2:211809194-211809216 CTCTCTTCATAAAATGAATTAGG + Intronic
945609953 2:211987637-211987659 ATGTGTAAATAAAATTAGGTAGG - Intronic
945732067 2:213551510-213551532 CTGGCCTGATAAAATGAAGTTGG + Intronic
946011976 2:216572659-216572681 TTCTGTTTATAAAATGAGGTGGG - Intronic
946980476 2:225208573-225208595 CTGTGTCACTAAAATGAATTGGG - Intergenic
947068129 2:226253707-226253729 CTGGCTTCATAAAATGAATTAGG - Intergenic
948156197 2:235784111-235784133 ATGTGTTAATAAAATATAGGGGG + Intronic
948228952 2:236335713-236335735 CTGTGTTAATGGAATAAGGTAGG - Intronic
1169952151 20:11056877-11056899 TTGTATTAATAATATGAATTTGG - Intergenic
1173350086 20:42236888-42236910 CTGTGTGAATAGAATGTGGTAGG + Intronic
1173905224 20:46623094-46623116 CTGTCCTCATAAAATGAATTGGG - Intronic
1175069426 20:56320018-56320040 CTGGCTTCATAAAATGAATTAGG - Intergenic
1176313910 21:5223896-5223918 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1176916271 21:14629465-14629487 CTGTGAGAATAAAATGAAGAAGG + Intronic
1177495727 21:21888678-21888700 CTGTATTAACAAAATGTATTAGG + Intergenic
1177819929 21:26020154-26020176 CTGTGTTAAGTGAAAGAAGTCGG + Intronic
1179357578 21:40674998-40675020 GTGTGTTTATATAATGAGGTGGG - Intronic
1180391729 22:12290013-12290035 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1180408016 22:12574743-12574765 CTCTGCAAATAAAATAAAGTTGG + Intergenic
1180673341 22:17570273-17570295 CTCTGCTAATAAGAGGAAGTAGG + Intronic
1181120656 22:20666411-20666433 CTGGCTTTATAAAATGAATTGGG + Intergenic
1182140136 22:27947764-27947786 CCGTTTTAAAAAAATTAAGTCGG + Intergenic
1182846037 22:33431804-33431826 TTGTGTTAAGAAACTGAAATGGG + Intronic
1182958950 22:34454048-34454070 CTGTGTTAGTCAAGTGCAGTGGG + Intergenic
949818440 3:8088064-8088086 CAGTGCTAATAAAATGAGATAGG + Intergenic
951867880 3:27327641-27327663 CTGTGCTATTATAATGAAGCAGG + Intronic
952273352 3:31853653-31853675 CTGTGTGAATAATAATAAGTAGG - Intronic
952445997 3:33381342-33381364 ATATGTAAATAAAATGAAATTGG + Intronic
952724306 3:36567150-36567172 CTAGCTTAATAAAATGAATTGGG - Intergenic
953192158 3:40698189-40698211 CTATGTTAAGAAAAGGACGTTGG - Intergenic
953607715 3:44422673-44422695 CTGTGTCAACAAAATGAGCTTGG + Intergenic
953723590 3:45378050-45378072 CTGGCTTAATAGAATGAATTAGG + Intergenic
955247730 3:57243853-57243875 ATTTTTAAATAAAATGAAGTTGG - Intronic
955312539 3:57903795-57903817 ATGTCTAAATAAAATGAATTTGG + Intronic
955324452 3:57999207-57999229 CTGTGGTAAGAGAATGAAGGCGG - Intergenic
955574617 3:60346767-60346789 CTGCCTTAATAAAAGGATGTAGG - Intronic
955808306 3:62759595-62759617 CTGTGTTAAATAAAAGAAGTGGG + Intronic
955827698 3:62965659-62965681 GTGTATTAATGAAATAAAGTAGG - Intergenic
955859804 3:63316239-63316261 CTGGCTTCATAAAATGAATTTGG + Intronic
956323216 3:68022360-68022382 CAGTGTTAGGTAAATGAAGTGGG + Intronic
956729729 3:72185585-72185607 TTATGTAAAAAAAATGAAGTAGG + Intergenic
957541925 3:81582474-81582496 ATGTGTTACAAAAATGAAATGGG - Intronic
957544350 3:81617721-81617743 CTGGCTTCATAAAATGAATTGGG + Intronic
957809280 3:85197259-85197281 CTGTGTTTATAAAATTATGTAGG - Intronic
958469969 3:94504429-94504451 CTGTCTTCATATAATAAAGTTGG + Intergenic
958542177 3:95492537-95492559 ATTTGTTAATAAAATGAATCTGG + Intergenic
958561000 3:95745856-95745878 CTGGTTTTATAAAATGAGGTGGG - Intergenic
958969621 3:100597494-100597516 CTGGCTTAATAGAATGAATTAGG + Intergenic
959143556 3:102516071-102516093 CTGACTTCATAAAATGATGTGGG + Intergenic
959312812 3:104762091-104762113 CTTTTTTAAAAAAATCAAGTAGG + Intergenic
959436466 3:106320833-106320855 CTGGCTTCATAAAATGAATTGGG - Intergenic
959898698 3:111635296-111635318 ATCTGTTAATAACATGTAGTGGG - Intronic
960997751 3:123350989-123351011 ATGTGTTAATAAAGGGCAGTGGG + Intronic
962049933 3:131802494-131802516 CTGTGTTATAAAATTGAAGTAGG + Intronic
962079544 3:132122698-132122720 CTGACTTTATAAAATGAATTAGG - Intronic
964824711 3:160812377-160812399 CTTTCTTCATAAAATGAAATTGG + Intronic
964893326 3:161562851-161562873 AAATGTTAATAAAATGAAGGTGG - Intergenic
965356491 3:167680687-167680709 CTGTGATAATAGACTGAAATTGG + Intergenic
965829589 3:172769855-172769877 TACTGTTAAGAAAATGAAGTTGG + Intronic
965983186 3:174718447-174718469 CTGTGTCAATAAAATAATGAAGG - Intronic
966119558 3:176506972-176506994 CTGTTATAATACAATGAAGATGG - Intergenic
966166155 3:177018652-177018674 GTGTGGGAATAAACTGAAGTTGG - Intergenic
966543811 3:181121322-181121344 ATATGTTAATAAAATAAATTTGG + Intergenic
967227872 3:187310306-187310328 CTGACTTCATAAAATGAATTAGG + Intergenic
968323241 3:197790537-197790559 ATCTGGTAATACAATGAAGTTGG + Intergenic
970570330 4:17374808-17374830 CTCTGTTAAATAAAAGAAGTGGG + Intergenic
971614322 4:28767604-28767626 CTGGCTTCATCAAATGAAGTAGG - Intergenic
971883571 4:32412978-32413000 CTGGCTTCATAAAATGAATTAGG - Intergenic
972225864 4:37011097-37011119 CTGTCTTAGTAAAATGAGTTTGG - Intergenic
972799099 4:42454125-42454147 CTGTTTTAAATAAATGAATTTGG - Intronic
972915144 4:43867791-43867813 CTGTCTTATGATAATGAAGTAGG - Intergenic
973286116 4:48418655-48418677 CTGGCTTCATAAAATGAATTGGG + Intronic
974323807 4:60387898-60387920 TTGTGATAATAAAATGAAGATGG - Intergenic
974655287 4:64811258-64811280 ATGTGTAAATAACAGGAAGTGGG + Intergenic
975282371 4:72575859-72575881 CTGTGTTTATGAAATAAAATTGG - Intergenic
975774466 4:77769625-77769647 CTGTTTTAAAAAAATGCACTGGG - Intronic
975872293 4:78793714-78793736 CAGTGTGAATAAAATGCACTTGG + Intronic
975899264 4:79131010-79131032 CTGTCTTCATAAAATAAATTTGG + Intergenic
975934959 4:79568442-79568464 ATCAGTTAATAAAATCAAGTAGG + Intergenic
976812940 4:89116304-89116326 CTTTGCTAATAAAAAGATGTTGG + Intergenic
976910161 4:90294972-90294994 TTGTGTTAATAAAATCAAATTGG - Intronic
977019601 4:91743081-91743103 CTGGCTTTATAAAATGAATTAGG + Intergenic
977044229 4:92049517-92049539 CTATGTTAACAAAATAAATTGGG - Intergenic
977319015 4:95487523-95487545 CAGTCTAAATAAAATGAATTAGG - Intronic
977496795 4:97785512-97785534 TTGTGTTCATACAATGAAGAAGG + Intronic
977680661 4:99795145-99795167 CTGTCCTCATAAAATGAATTAGG + Intergenic
978092690 4:104737265-104737287 CAGTGTTAATAAATTGAGGGTGG + Intergenic
979361254 4:119767583-119767605 CTGGCTTAATAAAAGGCAGTTGG + Intergenic
980190405 4:129517679-129517701 CTGTGTCTATTAAATGAATTGGG - Intergenic
980238143 4:130135161-130135183 CTGTCTTCATAGAATGAATTAGG - Intergenic
980487115 4:133473210-133473232 CTGTGTTAATTTAATGAATTTGG - Intergenic
980488717 4:133496140-133496162 TTGTTTTAATAAAAAAAAGTAGG - Intergenic
980507812 4:133745630-133745652 CTTTGTTCATAAAATGAGTTAGG + Intergenic
980570229 4:134606580-134606602 CTATGTTTAAAAAATGAGGTTGG - Intergenic
980843058 4:138290076-138290098 ATGTGATTATATAATGAAGTTGG + Intergenic
981205043 4:142031057-142031079 CTGTGTAAATAAAAAAAAGTAGG + Intronic
981741810 4:148010193-148010215 CTGTGTTAATAACATGATGTTGG + Intronic
981894281 4:149778979-149779001 CTGGATTAGTAAAATGAACTTGG - Intergenic
982189461 4:152839285-152839307 CTGGCTTCATAAAATGAATTAGG + Intronic
982473914 4:155827057-155827079 CCTTGTAAATAAAATGTAGTTGG + Intergenic
982637430 4:157914733-157914755 TTGTGGGAATTAAATGAAGTAGG - Intergenic
983387372 4:167082577-167082599 CTTGTTTACTAAAATGAAGTTGG + Intronic
983760964 4:171406128-171406150 CTGTGGAAAAAAAATGAACTTGG + Intergenic
984021584 4:174490086-174490108 TTTTCTTAGTAAAATGAAGTTGG - Intergenic
984303073 4:177949120-177949142 CTTTGATATTAAAATGAAGTTGG + Intronic
984344171 4:178500204-178500226 CTGTGATATTAAACTGGAGTTGG + Intergenic
984466598 4:180107416-180107438 CTGTGTTAGGAAAATGGAGAAGG + Intergenic
984865311 4:184275662-184275684 CTGAGTTTATTAAAGGAAGTGGG + Intergenic
985020866 4:185688689-185688711 CTGTGTTTACAAAATGAAGTAGG - Intronic
985121211 4:186643859-186643881 CTAGGTTAATAACATGTAGTGGG - Intronic
987494921 5:18630898-18630920 CTGTGTTAATGCAATGATCTAGG + Intergenic
987978848 5:25053546-25053568 CTATGTTCTTAAAATGAAATTGG - Intergenic
988600326 5:32633526-32633548 TTTTGTTAAAAAAATGAAATTGG - Intergenic
988908042 5:35810213-35810235 CTGTCTCAAAAAAATAAAGTGGG - Intronic
988978673 5:36541863-36541885 CTGGCTTAATAAAATAAATTGGG - Intergenic
989206404 5:38813280-38813302 ATGTGTTAAAAAAATAAAATTGG + Intergenic
989247843 5:39273810-39273832 ATGAGTTTAAAAAATGAAGTTGG - Intronic
989632719 5:43503005-43503027 GTATGTTAATAAAATTAACTTGG - Intronic
989951640 5:50306598-50306620 ATGTGTTCATAAAATGAGTTAGG - Intergenic
990712536 5:58601349-58601371 CTGGCTTCATAGAATGAAGTAGG + Intronic
991090574 5:62690380-62690402 CAGTTTAAATAAATTGAAGTAGG - Intergenic
991951844 5:71954218-71954240 ATGTGTTAAGAATATGAAGAAGG + Intergenic
992511927 5:77445409-77445431 CTGGCTTCATAAAATGAATTAGG - Intronic
992963260 5:81976406-81976428 CTGTGTTAAAATAATTAATTGGG + Intronic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
993268359 5:85760135-85760157 CTATATTAATAAAATGCAGTTGG + Intergenic
993586255 5:89733069-89733091 TAGTGTGTATAAAATGAAGTGGG + Intergenic
994796494 5:104307249-104307271 TTTTTTTAATAAAATAAAGTTGG + Intergenic
997121919 5:131183518-131183540 CTCTGTAAGTAAAATGAATTTGG - Intronic
997572124 5:134938405-134938427 TTTTGTTTATAAAATGATGTGGG + Intronic
997804368 5:136900602-136900624 CTGTCTTCATAAAATGAGCTCGG + Intergenic
998242433 5:140460049-140460071 CTCTGTTAATAAGAGGAGGTGGG + Intronic
999043824 5:148446049-148446071 ATATGTAAATAAAATGATGTTGG - Intergenic
999352379 5:150886404-150886426 CTGTTTTTATAGAATGAATTGGG + Intronic
999582562 5:153055598-153055620 CAGTGCTAATAAAATTAAGCTGG - Intergenic
1000327419 5:160182896-160182918 CTATGAGAATAAAATGAAATAGG - Intergenic
1001837947 5:174847772-174847794 CCTTGTTAATCAAATCAAGTGGG - Intergenic
1002381667 5:178833822-178833844 CTGGCTTTATAAAATGAATTGGG + Intergenic
1002947240 6:1774506-1774528 CTGTGTTATTAAAGTGGATTAGG + Intronic
1003236424 6:4299282-4299304 CTGAGTTTTTAAAATTAAGTAGG - Intergenic
1003632516 6:7800886-7800908 CTGTGGTCATAAAATAAAGCGGG + Intronic
1004711660 6:18176979-18177001 CTGGCTTCATAAAATGAATTAGG + Intronic
1005395753 6:25380204-25380226 CTGTGTTTTTAAAATAACGTCGG - Intronic
1005443850 6:25900487-25900509 ATGTGTTAATAAAGTGAAACTGG + Intergenic
1007064785 6:38978869-38978891 CTGTATTAATCAAATTAAGTAGG + Intronic
1007123678 6:39405692-39405714 CTGGCCTAATAAAATGAATTGGG + Intronic
1007646301 6:43384181-43384203 AAGTGATATTAAAATGAAGTTGG - Intergenic
1007931757 6:45698092-45698114 ACGTCTTAATAATATGAAGTTGG + Intergenic
1008233552 6:49014844-49014866 ATGTATTAAAAAATTGAAGTTGG + Intergenic
1009493062 6:64315703-64315725 CTGTCCTCATAAAATGAGGTAGG - Intronic
1009630925 6:66199056-66199078 ATAAGTTAATAAAATGAACTAGG + Intergenic
1010221524 6:73452426-73452448 CTGTCTTAAGAAGATGAGGTAGG + Intergenic
1010303361 6:74287309-74287331 GTATGTGAGTAAAATGAAGTAGG - Intergenic
1010387449 6:75298435-75298457 CTCTAGAAATAAAATGAAGTTGG - Intronic
1010456326 6:76060151-76060173 CTGAATGAAGAAAATGAAGTCGG + Intronic
1010576502 6:77538472-77538494 CTGTCTTCATAAAATGAGTTAGG - Intergenic
1011171972 6:84515042-84515064 CTGTGTTTATAAAGTCATGTAGG + Intergenic
1011261830 6:85477790-85477812 CTGTGTTTATTAAGTGATGTGGG + Intronic
1012063393 6:94515198-94515220 CTGGCTTAATAAAATGAGTTAGG - Intergenic
1012267051 6:97157824-97157846 CTGGCTTCATAAAATGAATTAGG + Intronic
1012421526 6:99070941-99070963 TTGTGTTAAAAAAATTAATTAGG - Intergenic
1012624057 6:101384860-101384882 ATGTGTGAAAAAAATGAGGTAGG + Intergenic
1012694240 6:102356651-102356673 CTGGGTTATAAAAATGAAGGTGG + Intergenic
1012828273 6:104174368-104174390 CAGAGTTAATAAAATGATTTTGG - Intergenic
1013609392 6:111779874-111779896 TTGTGAGAATAAAATGAGGTAGG - Intronic
1014372619 6:120630629-120630651 CTGGACTAATAAAATGAATTTGG - Intergenic
1014478824 6:121909617-121909639 CTGTATTTATAAAGTGAATTTGG + Intergenic
1014598565 6:123377957-123377979 TTGTGTTAAAACAATTAAGTTGG - Intronic
1014604198 6:123451733-123451755 CTGACTTCATAAAATGAATTGGG - Intronic
1014677757 6:124388568-124388590 TTGTATTTATAAAAGGAAGTAGG - Intronic
1015041514 6:128726212-128726234 ATGTCTTCATAAAATGAAATGGG + Intergenic
1015467665 6:133565675-133565697 ATGTTTTAAGAAAAAGAAGTGGG + Intergenic
1016323104 6:142869794-142869816 CTGTGTTAATAAAATGAAGTTGG - Intronic
1016595584 6:145795426-145795448 ATGGGTTAATAAAATGATTTTGG + Exonic
1016708430 6:147141247-147141269 CTTTGTAGACAAAATGAAGTGGG - Intergenic
1017282705 6:152640700-152640722 GTGTGCTAATAAAAGGAACTTGG + Intergenic
1017984634 6:159432817-159432839 CTGTATTAAAAAATTAAAGTAGG - Intergenic
1019982809 7:4633898-4633920 CTGGGTTCATAAAATGAAGGTGG - Intergenic
1020035547 7:4960858-4960880 CTGTATTAATAAAAAGGAATAGG - Intergenic
1021105263 7:16631338-16631360 CTGTATTTATAAAGTGAATTGGG + Intronic
1022015668 7:26346497-26346519 CTGTGTGAATCAAAATAAGTGGG - Intronic
1022947174 7:35298531-35298553 CTGTGTTGCAAAAATGAAGTTGG + Intergenic
1023085601 7:36567449-36567471 CTCTGTGAATTAAATGAAGATGG + Intronic
1024173758 7:46816712-46816734 CTGTGATAACAAATTGCAGTAGG - Intergenic
1024668994 7:51574304-51574326 CTGGGTTCATAGAATGAATTAGG + Intergenic
1026090782 7:67298888-67298910 CTCTATTAAAAAAATAAAGTAGG - Intergenic
1026601037 7:71777347-71777369 CTGTCTTAAAAAAATAAAGAAGG + Intergenic
1026637207 7:72094645-72094667 CAGTGTTAATAAGATGGAGATGG + Intronic
1027445731 7:78271459-78271481 CTGTCCTCATAAAATGAATTAGG + Intronic
1027863785 7:83620483-83620505 CTGGCTTCATAAAATGAATTAGG - Intronic
1028238428 7:88389085-88389107 ATGTGTGAAAAAAATGCAGTGGG - Intergenic
1028677954 7:93489895-93489917 CTGGCTTCATAAAATGAATTAGG - Intronic
1028901716 7:96108436-96108458 CTGTCCTCATAAAATGAATTAGG + Intronic
1029934441 7:104408616-104408638 TTGTGATGATAAAATGAATTTGG - Intronic
1030710302 7:112741116-112741138 CTTGGTAAATAAAATGAAGATGG - Intergenic
1031760957 7:125712709-125712731 CTGGCTTCATAAAATGAATTAGG + Intergenic
1032154582 7:129457538-129457560 CCCTGTTGATAAACTGAAGTGGG - Intronic
1032297746 7:130657280-130657302 ATGTGTTGAGAAAATGAAGAAGG + Intronic
1032617370 7:133489116-133489138 GTGTGATAAAAAAATGAAGAAGG + Intronic
1033133039 7:138761653-138761675 CTTTGATAATAAAATGCATTTGG - Intronic
1033227708 7:139574369-139574391 CTGTCTTAAAAAAAAAAAGTTGG + Intronic
1033267570 7:139899199-139899221 CTCTGTTAATAAATTATAGTCGG - Intronic
1033676753 7:143548474-143548496 CTGAGTTTATAAAATGAGCTGGG + Intergenic
1033695080 7:143780961-143780983 CTGAGTTTATAAAATGAGCTGGG - Intergenic
1033980940 7:147165117-147165139 CTGTTTTGATAAAAGGATGTTGG - Intronic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1034376824 7:150652972-150652994 CTGGCTTCATAAAATGAATTAGG + Intergenic
1034521899 7:151626829-151626851 CTGTGCTATTAAAATGTCGTGGG - Intronic
1034907155 7:154959833-154959855 CTGTATTATTAAGATGCAGTAGG - Intronic
1035599154 8:885905-885927 CTGGCTTAATAAAATGAGTTAGG + Intergenic
1035852063 8:2930334-2930356 CTGTGTTGAAAAAAAAAAGTGGG - Intergenic
1036657895 8:10689723-10689745 CTGTGTTCTTACAATAAAGTAGG + Intronic
1038576743 8:28710890-28710912 CTAGGTTTATAAAATGAACTGGG + Intronic
1039074244 8:33674705-33674727 GTGTGTTCAAAAAGTGAAGTTGG - Intergenic
1039170961 8:34744380-34744402 CTGTGTTAATCAAATTAGCTGGG + Intergenic
1039272823 8:35901591-35901613 CTGGGTTAAAAAAATGAAACTGG - Intergenic
1039484531 8:37900272-37900294 CTGTCTCAAAAAAATAAAGTTGG + Intergenic
1039636744 8:39175682-39175704 CTGGGTTCATAAAATGAATTGGG + Intronic
1040536224 8:48313383-48313405 GTGTGGAAATAAAATGAAGCGGG - Intergenic
1040635383 8:49267310-49267332 CTGGCTTCATAAAATGAATTAGG + Intergenic
1041140861 8:54817906-54817928 TTGTGAAAATAAAATGAAATAGG - Intergenic
1041188115 8:55323693-55323715 CTGTGTAAATACCAAGAAGTGGG + Intronic
1041305266 8:56451160-56451182 CTGTTTTAATAAAATTATATAGG + Intergenic
1041544565 8:59027406-59027428 CTGTGTTAGTCACATGAAATGGG + Intronic
1042293326 8:67192772-67192794 CGGAGTTAACAAAATGCAGTGGG - Intronic
1042449119 8:68923669-68923691 CTGTGTTACCAAAGTGAACTGGG - Intergenic
1042571193 8:70166813-70166835 CTGAATTATTAAAATGATGTAGG + Intronic
1042644640 8:70972970-70972992 CTGTCTTCATAAAATGATTTAGG + Intergenic
1043381922 8:79711675-79711697 CTGGCTTCATAAAATGAATTAGG - Intergenic
1043397282 8:79851289-79851311 CTGTCTTAAAAAAAAAAAGTGGG + Intergenic
1044430157 8:92098978-92099000 CTGTGGAAAAAAAGTGAAGTTGG + Intronic
1044502715 8:92978191-92978213 CTGAGTTAAGAAGATGTAGTTGG - Intronic
1049138138 8:140924319-140924341 CTGTGGGAATAAAATGAAGCAGG - Intronic
1049295575 8:141833228-141833250 CATTGTTAAGAAAATGAAGAAGG - Intergenic
1050404815 9:5296658-5296680 CTGTCTTCATAAAATGAGTTAGG - Intergenic
1050982644 9:12039477-12039499 CTGTCTTTATAAAATGAGTTAGG - Intergenic
1051827815 9:21240218-21240240 CTGTGTTATTAAAATTTAATGGG - Intergenic
1051833280 9:21305537-21305559 CTGTGTTATTAAAATTTAATGGG - Intergenic
1052226422 9:26094118-26094140 CTGTCTTCATAAAATGACATGGG + Intergenic
1052371502 9:27670356-27670378 CTGTGTATATAAAATTCAGTAGG - Intergenic
1054353198 9:64037802-64037824 CTGGGTTAATAAAATAAGATAGG - Intergenic
1055023495 9:71694750-71694772 CTGTGTTAAGAATATCAAGATGG - Intronic
1055517002 9:77043574-77043596 CTGTGTTGAAAAACTGAAGTAGG + Intergenic
1055911174 9:81353857-81353879 CTGTCTTCATAGAATGAATTAGG + Intergenic
1056761500 9:89418799-89418821 CTGTGTTAATAGAATCATGGAGG - Exonic
1057381741 9:94573826-94573848 CTGGTTTCATAAAATGAATTGGG + Intronic
1057859728 9:98630742-98630764 CTCTGTTAAAAAAATGAAAAAGG + Intronic
1058021612 9:100095667-100095689 CAGTTTTAATAAAATGATATCGG - Intronic
1058156427 9:101521223-101521245 CTGGCTTCATAAAATGAATTAGG + Intronic
1059552247 9:115240953-115240975 CTTTGCTAATAAAATGCAGATGG + Intronic
1059787896 9:117606512-117606534 CTGTTTTAATAAACAGAGGTGGG - Intergenic
1061171467 9:128959029-128959051 CTGTGTTGATAAATTGGAGAAGG + Exonic
1186035264 X:5415566-5415588 GTGTGTTATTAAAATTAATTTGG + Intergenic
1186123218 X:6384925-6384947 CTGTGTTCATAAAGAGAAGTGGG + Intergenic
1186934926 X:14438640-14438662 CTGGCTTTATAAAATGAATTTGG + Intergenic
1188465304 X:30472818-30472840 CTGTGTTATGAATAGGAAGTGGG - Intergenic
1188748401 X:33874882-33874904 CTGCTATAAGAAAATGAAGTTGG + Intergenic
1189190892 X:39104067-39104089 CGATGTTAAAAAAATAAAGTTGG + Intergenic
1189618754 X:42813178-42813200 CTGGCCTAATAAAATGAATTAGG + Intergenic
1189782064 X:44524894-44524916 CTGTGTTAATAACTTGATGATGG - Intronic
1190149655 X:47934084-47934106 CTGGCCTAATAAAATGAATTGGG + Intronic
1190449232 X:50561364-50561386 CTGGCTTCATAAAATGAATTGGG - Intergenic
1190895164 X:54610853-54610875 CTGGCTTCATAAAATGAATTAGG + Intergenic
1191658312 X:63623694-63623716 CTGGCCTCATAAAATGAAGTGGG + Intergenic
1192399399 X:70819079-70819101 CTGATTTCATAAAATGAATTTGG - Intronic
1193019992 X:76781129-76781151 CAGTCTCAATGAAATGAAGTAGG + Intergenic
1193080389 X:77400615-77400637 CTGTATTAAGAAAATGAATGTGG - Intergenic
1193107953 X:77699915-77699937 CTGTTTTCATAAAATGAGTTGGG - Intronic
1193952734 X:87821386-87821408 CTGAGTTAATAATATTAAGGGGG - Intergenic
1194816528 X:98448300-98448322 CTGTAATAGTAAAATGAATTAGG - Intergenic
1194926375 X:99829916-99829938 CTGGTTTCATAAAATGAATTAGG + Intergenic
1195167298 X:102232985-102233007 CTGTCCTCATAAAATGAACTAGG + Intergenic
1195191561 X:102454102-102454124 CTGTCCTCATAAAATGAACTAGG - Intronic
1196373834 X:115009271-115009293 TTGTGTCAATAAATTAAAGTTGG - Intronic
1196601931 X:117611418-117611440 CTGGGTTACTGAAATGATGTGGG + Intergenic
1197519221 X:127476362-127476384 CTCTCTTTATAAAATGAATTAGG - Intergenic
1197966672 X:132070545-132070567 TCATGTTAATAAAATGAAGGCGG + Intergenic
1197979474 X:132200083-132200105 CTGTCTTAAAAAAAAGAAGTCGG + Intergenic
1198153261 X:133932075-133932097 CTGTTTTAATAAAGAGAGGTGGG - Intronic
1198338552 X:135691888-135691910 CAGTGTTAAAAAAATAAATTAGG + Intergenic
1198812749 X:140552164-140552186 CTGTCTCAAAAAAATGAAGTTGG - Intergenic
1201061420 Y:10050083-10050105 CTGAGTTAAGACAATGAATTTGG + Intergenic
1201473821 Y:14360058-14360080 CTGTGTTCATAAAGAGTAGTGGG - Intergenic
1201756036 Y:17486217-17486239 CCGTGTTCATAGAATGAATTAGG - Intergenic
1201845516 Y:18419768-18419790 CCGTGTTCATAGAATGAATTAGG + Intergenic