ID: 1016323144

View in Genome Browser
Species Human (GRCh38)
Location 6:142870115-142870137
Sequence CTGCAGACCCAGGTGGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 301}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016323144_1016323157 19 Left 1016323144 6:142870115-142870137 CCAAGACCCACCTGGGTCTGCAG 0: 1
1: 0
2: 2
3: 50
4: 301
Right 1016323157 6:142870157-142870179 CCTTTGGGGTTCAGCACCAAAGG No data
1016323144_1016323149 3 Left 1016323144 6:142870115-142870137 CCAAGACCCACCTGGGTCTGCAG 0: 1
1: 0
2: 2
3: 50
4: 301
Right 1016323149 6:142870141-142870163 CCCACACCCTGCCAATCCTTTGG No data
1016323144_1016323152 5 Left 1016323144 6:142870115-142870137 CCAAGACCCACCTGGGTCTGCAG 0: 1
1: 0
2: 2
3: 50
4: 301
Right 1016323152 6:142870143-142870165 CACACCCTGCCAATCCTTTGGGG No data
1016323144_1016323151 4 Left 1016323144 6:142870115-142870137 CCAAGACCCACCTGGGTCTGCAG 0: 1
1: 0
2: 2
3: 50
4: 301
Right 1016323151 6:142870142-142870164 CCACACCCTGCCAATCCTTTGGG 0: 1
1: 0
2: 0
3: 24
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016323144 Original CRISPR CTGCAGACCCAGGTGGGTCT TGG (reversed) Intronic
900148655 1:1168889-1168911 CTGCAGACCCAGGAGGGATCAGG + Intergenic
900406930 1:2496864-2496886 CTGCAGAATCTGGTGGGCCTTGG - Exonic
900640732 1:3687019-3687041 CAGCAGAGCCAGGAGGGCCTAGG + Intronic
900962805 1:5936360-5936382 CTGCAGAGCCAGGTGGTTTTCGG - Intronic
901132638 1:6971821-6971843 CTGCTAACCCAGGTGTGACTTGG + Intronic
901151812 1:7108415-7108437 CCGCAGACCCAGATGGCCCTGGG + Intronic
901451705 1:9339999-9340021 CTGCATGCCCAGGTGGTTCAGGG - Intronic
901889418 1:12249908-12249930 CTGCAGACCCCGCTGGGTAAGGG + Intronic
902140232 1:14347454-14347476 CTGGGGACCCGGGTGGATCTTGG - Intergenic
902630290 1:17700819-17700841 CTGCAAACCCAGTGGGCTCTGGG - Intergenic
902807901 1:18872300-18872322 CTACTGGCCCAGGTGGGTCTGGG + Exonic
903288269 1:22290669-22290691 CACCAGCGCCAGGTGGGTCTAGG - Intergenic
903322995 1:22553706-22553728 CTGGAGACCCATGTGGTTCAGGG - Intergenic
903375171 1:22861223-22861245 CTGCTCACACAGGTGGGTCTGGG + Intronic
903538304 1:24082002-24082024 TTGCAGACCCGGGTGGGGATGGG + Exonic
903731830 1:25502111-25502133 ATGCAGATTCAGATGGGTCTGGG - Intergenic
904011944 1:27394885-27394907 CTCCAGAACCAGCTGGGTCTGGG - Exonic
904396782 1:30227638-30227660 CTGTAGACCTAGGAGGGGCTTGG - Intergenic
904772639 1:32888866-32888888 TTGGGGACCCAGGTGGGACTTGG + Exonic
906031400 1:42723105-42723127 CTGTAGTCCCAGGCGGGACTCGG + Intergenic
909434571 1:75625881-75625903 CTGGTGCACCAGGTGGGTCTGGG + Intergenic
910748822 1:90605187-90605209 CTGAAAGCCCAGGTGGGCCTGGG - Intergenic
911478744 1:98409344-98409366 CTGCAGACCCAGGGGGCATTCGG - Intergenic
912519075 1:110233126-110233148 CATCAGACCCAGATGGCTCTGGG - Exonic
912572436 1:110634333-110634355 CTGGAGACCAAGGTGGGGCCAGG - Intergenic
913591803 1:120336133-120336155 CTGCAGGCCCAGGTGGATTAGGG + Intergenic
913651553 1:120919013-120919035 CTGCAGGCCCAGGTGGATTAGGG - Intergenic
914599002 1:149181814-149181836 CTGCAGGCCCAGGTGGATTAGGG - Intergenic
914641732 1:149613116-149613138 CTGCAGGCCCAGGTGGATTAGGG - Intergenic
914928038 1:151906185-151906207 CTGGAGTTCCAGGTGGGTGTGGG + Intronic
915441501 1:155948096-155948118 CTGCAGGCTCAGGGGGCTCTGGG + Intronic
918434230 1:184494998-184495020 CTGCAGTCCCAGGAGGTTCTAGG - Intronic
920963343 1:210682858-210682880 CTGCAGTCCATGGGGGGTCTTGG + Exonic
922063932 1:222117760-222117782 CTCCAGTCCCAGGAGGGACTTGG - Intergenic
924443400 1:244105265-244105287 CTGCATACCCAGGAAGCTCTGGG - Intergenic
1063367033 10:5497044-5497066 CTGAAGCCCCAGGTGGGTACAGG - Intergenic
1063980557 10:11448397-11448419 CTACAGCCCGAGGTGGGGCTGGG + Intergenic
1066046868 10:31602764-31602786 CTGGAGCCCCAGCTGGCTCTTGG + Intergenic
1066347598 10:34603957-34603979 CTTCAGTCCCAGGTGCGTCCAGG + Intronic
1067683522 10:48454516-48454538 CTGCAGCCCCAGGTGGCTCAGGG - Intronic
1069780960 10:70955050-70955072 CTCTGGACCCAGGTGGGTCCTGG - Intergenic
1071259581 10:83908054-83908076 CTGCAGGCCAAAGAGGGTCTGGG - Intergenic
1072713840 10:97736402-97736424 ATGCAGACCAAGGTGGGTGGTGG + Intergenic
1073206032 10:101769925-101769947 CTGCACCCCCAGGTGGGGCAGGG - Intergenic
1074129305 10:110559160-110559182 CTGCAGACTGAGGTGGATTTGGG - Intergenic
1075669102 10:124251032-124251054 CTCCAGACCAAGGTGGGACTGGG + Intergenic
1075815541 10:125261913-125261935 ATGCAAACCCAGGTTTGTCTGGG + Intergenic
1076111455 10:127862749-127862771 CTGAGGGACCAGGTGGGTCTGGG + Intergenic
1076903511 10:133351287-133351309 ATGCAGCCCCAGGTGGGCCTCGG + Intronic
1077171582 11:1168684-1168706 CTGCAGGCCCAGGCTGGTCTGGG - Exonic
1077281691 11:1748966-1748988 CGGCAGACCCGGATGGGGCTGGG - Intronic
1077386774 11:2272983-2273005 CAGCAGACGCAGGTGGGTGCAGG - Intergenic
1078436154 11:11327613-11327635 CTGCAGACCCAGCAGTGGCTTGG + Intronic
1079137333 11:17783271-17783293 CTGCAGATCCTGTTGGGTCAGGG + Intergenic
1080561609 11:33468500-33468522 CTGCAGTCGCAGGTGTGTCCTGG - Intergenic
1081811066 11:45914362-45914384 CTGCAGCCCCAGGGGGGTGGGGG + Exonic
1082009684 11:47441734-47441756 CTGCAGAGCCAGGTGGGGGATGG + Intronic
1082026631 11:47577469-47577491 CAGCTGGGCCAGGTGGGTCTTGG + Exonic
1082781980 11:57294923-57294945 CTGCACCCCTGGGTGGGTCTGGG - Intergenic
1083456499 11:62782368-62782390 CTGCAGAGCCAAGTGGGTTGGGG + Intronic
1084576745 11:69993554-69993576 CTGAAGACCGAGCTGGGACTAGG - Intergenic
1084804738 11:71571203-71571225 CTGCAGACCCAAGGCTGTCTGGG + Intergenic
1084805718 11:71577320-71577342 CTGCAGACCCAAGGCTGTCTGGG - Intergenic
1085320968 11:75573689-75573711 CTGCAGACCCATGTACATCTTGG - Intergenic
1089139110 11:116272271-116272293 CTGAGGACCCAGCTGGGCCTGGG + Intergenic
1089664910 11:120012322-120012344 CGGCAGTCCCCGGGGGGTCTGGG - Intergenic
1090238624 11:125166538-125166560 CCGCAGACCCAGGTGGCTCCTGG - Intronic
1090239722 11:125173633-125173655 CTTCAGTCTCAGGTGGGGCTGGG + Intronic
1090398960 11:126436219-126436241 CTGCAGACCCAGGAGGCACATGG - Intronic
1090803952 11:130190851-130190873 CTGCAGCTCCAGGGGAGTCTGGG + Intronic
1091438202 12:490909-490931 CTGCAGACCCATCTGGGCCTGGG - Intronic
1094264179 12:28536977-28536999 CTGCAGAACCAGCTTGTTCTGGG + Intronic
1094718219 12:33034243-33034265 CTGGAGTTCCAGGTGGGTGTGGG - Intergenic
1094819114 12:34211209-34211231 CCCCGGACCCAGGTGGGTCGTGG - Intergenic
1097141101 12:56903026-56903048 CTGGAGACCCAGATGACTCTGGG + Intergenic
1101398533 12:104368814-104368836 CTGGAAGCCCAGGTGGGGCTTGG - Intergenic
1101490830 12:105208048-105208070 CTGAACACCCAGGAGGGTCAGGG + Intronic
1102786877 12:115612149-115612171 CTGAGGATCCAGGTGGTTCTGGG + Intergenic
1103743461 12:123106895-123106917 CTGCATTCCCATGTGGGACTAGG + Intronic
1104684720 12:130777415-130777437 CTTCAGACCCAGCTGGATCCTGG + Intergenic
1104757909 12:131280404-131280426 CTGCAGACCCTGATGGGTCAGGG - Intergenic
1104947720 12:132424037-132424059 CTGCAGACCCACAAGGGCCTGGG + Intergenic
1105265194 13:18809041-18809063 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
1105303632 13:19155001-19155023 CTGCTGGCCCTGGTGGGCCTGGG + Intergenic
1106768698 13:32941213-32941235 TTGCAGACCCAGGGGAGACTGGG - Intergenic
1107958907 13:45542154-45542176 CTGCAGACCCAGGCAGAACTTGG - Intronic
1108251234 13:48570100-48570122 CAGCAGGGCCAGGAGGGTCTAGG - Intergenic
1112440359 13:99420635-99420657 CCGAAGACCTAGGTGGTTCTGGG - Intergenic
1113661475 13:112108948-112108970 CTGAACACCAAGGTGGCTCTTGG + Intergenic
1114221247 14:20699411-20699433 CTGCTGACCCTGCTGGGGCTGGG + Exonic
1115165977 14:30449056-30449078 CTTCAGAGCCAGGTTGTTCTGGG - Intergenic
1117534457 14:56690333-56690355 GTGCAGACTCAGCTGGGTTTGGG + Intronic
1119386634 14:74261431-74261453 CTGCAGACCTGGCTGGGCCTGGG + Exonic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121429863 14:93879116-93879138 CTGCTAACCCAGGTGGCTCAGGG - Intergenic
1121974392 14:98389547-98389569 CTGCAGACCCAGGAGAGTCGAGG - Intergenic
1122326052 14:100881228-100881250 CTGCAGGCCTCGGTGGGCCTGGG + Exonic
1122834805 14:104425401-104425423 CTGCAGCACCGGGAGGGTCTTGG + Intergenic
1123100082 14:105791809-105791831 TAGCAGAGCCAGGTGGGTCATGG - Intergenic
1124254112 15:28127229-28127251 CTGCAGACGCAGCTGGGCATAGG + Intronic
1124848827 15:33316394-33316416 GTGCAGACCCAGGCGGTCCTAGG + Intronic
1125832947 15:42729229-42729251 CTGCAGCCCCTGGCTGGTCTGGG + Exonic
1126140082 15:45430357-45430379 CTGCCGACCCCGGTCGCTCTTGG - Intergenic
1126673145 15:51134842-51134864 CTGAGGACCCAGGTGAGTTTGGG + Intergenic
1127485126 15:59411788-59411810 CTGTAGTCCCAGCTGAGTCTGGG + Intronic
1127906417 15:63379626-63379648 CTGCAGACCCAGCTGGTACTGGG + Intronic
1128874881 15:71193831-71193853 CTGTAGTCCCAGGGGGGACTAGG - Intronic
1129189862 15:73930937-73930959 CAGGAGACCCAGCTGGGCCTGGG - Intronic
1129411916 15:75354968-75354990 CTGCAGACCCCGGAAGGTCAAGG + Exonic
1129692332 15:77720950-77720972 CTGCTGACCCAGGAGAGTCCCGG - Intronic
1131267300 15:90924262-90924284 CTGCAGACCCAGCTGGTCCTGGG - Intergenic
1132359431 15:101200590-101200612 CTGCACCCCCAGATGGGTCAGGG + Intronic
1132569735 16:638832-638854 CTTCTGACCCAGGTGTCTCTTGG - Intronic
1132572770 16:651255-651277 CTCCTGAGGCAGGTGGGTCTGGG + Exonic
1132686229 16:1163265-1163287 CAGCAGGGCCAGGTGGGTGTCGG + Intronic
1133182420 16:4067463-4067485 CTCCAGACCAAGATGGGTCTGGG + Intronic
1133216759 16:4297241-4297263 CTGCAGCCCCAGCTGGGACCAGG + Intergenic
1133335317 16:5003363-5003385 CAGCAGAGCCAGGTGGAGCTGGG + Intronic
1133573345 16:7063715-7063737 GTGCAGACCCAGGTGTGTGTTGG - Intronic
1133678111 16:8095080-8095102 CTGCAGACCCAGGCGAGACAAGG + Intergenic
1134055525 16:11167486-11167508 CTGCAGAGCCAGGGAGGTCGAGG + Intronic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1134503236 16:14785413-14785435 CTTCGGAGCCAGGTGGGCCTGGG - Intronic
1134577329 16:15343485-15343507 CTTCGGAGCCAGGTGGGCCTGGG + Intergenic
1134725116 16:16413008-16413030 CTTCGGAGCCAGGTGGGCCTGGG - Intergenic
1134942316 16:18298850-18298872 CTTCGGAGCCAGGTGGGCCTGGG + Intergenic
1136065199 16:27753973-27753995 ATGCAGACCCTGGAGGGTCAGGG + Intronic
1136275390 16:29176759-29176781 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1136505040 16:30697978-30698000 ATGCAGCCCCAGGTAGATCTAGG + Intergenic
1137553428 16:49455625-49455647 CAGCAGAGCCAGATGGGTCCTGG - Intergenic
1138369051 16:56509846-56509868 CTCCAAACCCAGGTGGTTTTAGG - Intronic
1139323570 16:66134591-66134613 CTGGAGATCCTGGTGGGTATGGG - Intergenic
1139823909 16:69742174-69742196 CTGCAGACCCAGCGGGGCATGGG + Exonic
1141502120 16:84451508-84451530 CTGCAGACCGAGGAGGATCTGGG + Intronic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1141705324 16:85661550-85661572 CTGCTGGCCCAGGATGGTCTGGG - Exonic
1142003204 16:87675789-87675811 CTTCTGACCCAGGAGGGGCTGGG + Intronic
1142025482 16:87810625-87810647 CTGCAGCCCCAGGTGGACCTTGG + Intergenic
1142079750 16:88142824-88142846 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1142115641 16:88354798-88354820 AAGCTGACCAAGGTGGGTCTAGG - Intergenic
1143320433 17:6065046-6065068 CTGCAGACACAGGGGTGTCAGGG - Intronic
1143551702 17:7634373-7634395 CTGCGGAACCAGGTGGGTCCTGG - Intergenic
1143627475 17:8118789-8118811 CTGCAGGCCCAGGGCGGTCCTGG - Exonic
1143781219 17:9230659-9230681 CTCCAGGCCCAGGAGGCTCTGGG + Intronic
1144783440 17:17819218-17819240 CTGCAGACCCTGGTGAGTGGCGG - Exonic
1144858170 17:18282384-18282406 CTTCAGATCTAGGTGGGTCTGGG - Intronic
1144964920 17:19070762-19070784 CCGCAGACTCTGGTGGGACTGGG + Intergenic
1144983047 17:19181416-19181438 CCGCAGACTCTGGTGGGACTGGG - Intergenic
1144985177 17:19196823-19196845 CCGCAGACTCTGGTGGGACTGGG + Intergenic
1146812966 17:35918222-35918244 CGGCCGACCCAGGTGGTTCCAGG + Exonic
1146924505 17:36734961-36734983 CAGAAAACCTAGGTGGGTCTGGG + Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147559235 17:41498919-41498941 CTACAGAACAAGGTGGGGCTCGG - Intergenic
1147625085 17:41895020-41895042 CAGCAGAACCCGGGGGGTCTAGG - Intronic
1150246059 17:63676255-63676277 CTACAGACCCAGGAGGGTCTGGG - Intronic
1151404595 17:73878232-73878254 CTGAAGACCCAGGCGGCACTAGG - Intergenic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151944696 17:77313183-77313205 CTGCAGAGCGAGGGAGGTCTGGG - Intronic
1152289016 17:79428330-79428352 CTGCAGACCCACCCTGGTCTGGG + Intronic
1154016106 18:10619365-10619387 CTTCAGGCCCAGATGGCTCTAGG + Intergenic
1154189407 18:12216276-12216298 CTTCAGGCCCAGATGGCTCTAGG - Intergenic
1154423201 18:14252503-14252525 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
1154428877 18:14293286-14293308 CTGCACACAGAGGTGGGTCATGG - Intergenic
1155775273 18:29753278-29753300 CAGCAGACCCAAGGGGCTCTCGG + Intergenic
1159025411 18:63178635-63178657 CATCAGACCCAAGTGAGTCTGGG - Intronic
1160221345 18:76980145-76980167 CTGAAGACCCACGTGCGTCTGGG + Intronic
1160576384 18:79856649-79856671 CTGCAGTCCCAGGCGGGGTTCGG - Intergenic
1160816672 19:1039200-1039222 CTGAAGCCACAGGTGAGTCTGGG + Intergenic
1161302908 19:3551548-3551570 CGGGAGGCCCAGGTGGGCCTGGG + Intronic
1161596664 19:5154214-5154236 GTGCAGGCCCTTGTGGGTCTCGG + Intergenic
1161782346 19:6301559-6301581 CTGCAGACCTGGCTGGGTCCAGG - Intergenic
1162506917 19:11090879-11090901 CTGCAGACCAAGGAGGGGCGGGG - Intronic
1163110909 19:15160698-15160720 CTGGGGCCCCAGCTGGGTCTGGG + Exonic
1163393274 19:17043744-17043766 CTGCAGACCCATGTGGGATTTGG - Intergenic
1163393738 19:17046392-17046414 CTGCAGATCCATGTGGGATTTGG + Intergenic
1163846312 19:19640175-19640197 CTGCAGAGGCATGTGGCTCTGGG + Exonic
1163862669 19:19750334-19750356 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
1163953660 19:20614060-20614082 CTGCAGCCAGCGGTGGGTCTGGG - Intronic
1164735851 19:30540325-30540347 CTGCACACCCAGTCGGGTGTAGG + Intronic
1164934339 19:32199590-32199612 CTTCAGGCCCAGGTGGGTTTTGG - Intergenic
1165449025 19:35871719-35871741 CTGCTGTCCCAGATGGGTCGGGG - Exonic
1165906826 19:39199362-39199384 CTGTAGCACCAGGAGGGTCTTGG - Intronic
1166912962 19:46173941-46173963 CTGCAGCCTCAAGTGTGTCTGGG + Intergenic
1167003115 19:46757380-46757402 CTTCGGAGCCAGGTGGGCCTGGG + Exonic
1167667958 19:50833609-50833631 CCCCAGACCCAGCTGGGACTGGG - Intronic
1167856179 19:52242260-52242282 CTGCATACAGAGGTGTGTCTTGG + Intergenic
1167858562 19:52264128-52264150 CTGCATACAGAGGTGTGTCTTGG - Intergenic
1168098642 19:54129191-54129213 GGCCAGACCCAGGTGGGGCTGGG + Intronic
1168400605 19:56084207-56084229 CTGTATACCCGGGTGGGGCTGGG - Intergenic
1168650956 19:58091816-58091838 CTTCAGACCCAGGCGGTTCCTGG - Intronic
925173411 2:1766618-1766640 CTGCAGTCCAAGGTAGGGCTTGG - Intergenic
926621843 2:15053647-15053669 CTGCAGACCCGGGGGGATCTCGG + Intergenic
926820591 2:16847663-16847685 CTGTAGTCCCAGGTGGGTCGAGG - Intergenic
929385973 2:41407219-41407241 CTTCAGACCCACCTGGGACTTGG - Intergenic
929660584 2:43780344-43780366 CTTCACACCCACATGGGTCTTGG - Intronic
933560573 2:83880518-83880540 CTGCATACCCAGGTGCATCTTGG - Intergenic
934553730 2:95276875-95276897 CTGCAGAGCCCGGTGGGGCCTGG + Intronic
935408680 2:102736575-102736597 CTGGGGACCCAGGCGGTTCTTGG - Intronic
936648532 2:114400051-114400073 CTGCACACCCAGTTTGGCCTTGG + Intergenic
937325812 2:120989060-120989082 CGGCAGCCCCAGGTCGGCCTCGG - Exonic
937337217 2:121069374-121069396 CTACAGACCCAGGTGGGCCCTGG + Intergenic
938263065 2:129908972-129908994 CAGCAGAGCCAGATGGCTCTGGG - Intergenic
938783050 2:134602773-134602795 CAGAAGACCCAGGAGGGCCTGGG - Intronic
942057275 2:172196265-172196287 GTGCAGACCAGGGTGGTTCTGGG - Intergenic
944098426 2:195995558-195995580 CTGCTGAGCCAGGTTGGTTTCGG - Intronic
946158496 2:217822088-217822110 CTGCAGGGCAGGGTGGGTCTGGG - Intronic
946184639 2:217973231-217973253 CTGCAGTCCCAGCTCGGACTCGG + Intronic
946734461 2:222740520-222740542 CTGGAGAACCAGGTGAGTCTTGG + Intergenic
947746183 2:232508457-232508479 CTGCTCACCCAGGTGGGCCCTGG + Intergenic
947769989 2:232662873-232662895 CTTCAGGCCCAGGTGGGTCTGGG - Exonic
947798959 2:232915099-232915121 CAGGAGAGCCAGGAGGGTCTGGG - Intronic
948116276 2:235495763-235495785 CTGGTGCCCCAGGTGAGTCTTGG - Intronic
948120069 2:235523341-235523363 CTGGAGCCCCAGGAGGCTCTTGG + Intronic
948601304 2:239108893-239108915 CTGCCGGCCCAGTTGGTTCTGGG - Intronic
948897720 2:240935040-240935062 CTGGAGAGCCAGGTGGTTCAGGG - Intronic
1171018116 20:21560243-21560265 CTGCAGCCCCTGGTGGGGCTGGG + Intergenic
1171886028 20:30652981-30653003 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
1172094063 20:32452178-32452200 CTGCAGACCCAGCTGGGTGCTGG + Intronic
1172331519 20:34079033-34079055 CTGCAGCCACAGGAGGCTCTTGG - Intronic
1175169122 20:57067612-57067634 CTGGAGACCCAGGAGGATCTGGG + Intergenic
1175794315 20:61762042-61762064 CAGCAGAGCCAGGTGGGCCCTGG - Intronic
1176024896 20:62980971-62980993 CCGGGGACCCCGGTGGGTCTGGG - Intergenic
1178198131 21:30371945-30371967 CTGCAGAGCAAGGAGGTTCTGGG + Exonic
1178200374 21:30396333-30396355 CTGCAGAGCAAGGAGGTTCTGGG - Exonic
1178258406 21:31076304-31076326 CTGAAGACCCTCCTGGGTCTGGG - Intergenic
1179380061 21:40890170-40890192 CTGGAGGCCCAGGGAGGTCTAGG + Intergenic
1179590770 21:42406378-42406400 CTGTAGACCCAGGGGCGTTTGGG + Intronic
1179903272 21:44406071-44406093 CTGCAGCCCAGGGTGGGCCTCGG + Intronic
1180247497 21:46557914-46557936 CTGCAGAGACAGGTGGGCCGTGG - Intronic
1181013214 22:20054210-20054232 GTGCAGACCCATGTGGGGCAGGG - Intronic
1181031314 22:20149944-20149966 CAACAGTCCCAGGTGGGCCTGGG - Exonic
1181128138 22:20713648-20713670 GTGAAGACCCAGGTGTGCCTGGG + Intronic
1181375020 22:22450578-22450600 CTGCACACCCAAGAGTGTCTGGG - Intergenic
1182394672 22:30026663-30026685 ATGGGGACCCAGGTGTGTCTGGG - Exonic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184411921 22:44330957-44330979 CTGCGGACCCAGAGGGGCCTGGG - Intergenic
1184417424 22:44360442-44360464 CTGCAGCCCCGGGTGGGGCAGGG - Intergenic
1184508564 22:44918614-44918636 CTGCTGTCCCAGGTGGCTCACGG - Intronic
1184558800 22:45249009-45249031 GAGCAGAGCCAGGTGGGACTGGG + Intergenic
1184605972 22:45575119-45575141 CTGCTGTGCCAGGTGGGTGTGGG - Intronic
1184681539 22:46074821-46074843 CTTCTCACCCAGGAGGGTCTGGG - Intronic
1185232734 22:49692832-49692854 CTGCACAGCCAGGTGGGTCCAGG + Intergenic
950202883 3:11057311-11057333 CAGCTGACCCAGCTGGGTCAGGG - Intergenic
950428061 3:12935252-12935274 CAGCAGTCCCAGGAGGGGCTAGG + Intronic
953413890 3:42704609-42704631 CTGCAGACCCTGCTGTGTGTGGG - Intronic
953759376 3:45674667-45674689 CTGCAGAGCTAGGAGGGTCGTGG + Intronic
954798329 3:53172689-53172711 TTGCAGCCCCTGGTGGGTATAGG - Intronic
957053306 3:75426420-75426442 ATGCAGGCCCAGGTGGGCGTGGG + Intergenic
959663167 3:108891996-108892018 CTGCACACCCAAGTCTGTCTCGG - Intergenic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
962084163 3:132173294-132173316 CTGCAGGCCCGGATGGGTCGGGG - Intronic
962486988 3:135853388-135853410 CCTCAGACCCAGGTAGGTCCTGG + Intergenic
964037516 3:152217352-152217374 CTGGAGTTCCAGGTGGGTGTGGG + Intergenic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
966396504 3:179509583-179509605 CTGCAAACCCAGGTGGGACAGGG - Intergenic
966888064 3:184387504-184387526 CTGCAGACCCCGCTGGGTTATGG - Intronic
968867892 4:3225495-3225517 GTGCAGAGCCCTGTGGGTCTTGG - Intronic
968960862 4:3742942-3742964 CTGCTGAGCTGGGTGGGTCTAGG - Intergenic
969111314 4:4846088-4846110 CAGCAGACCCCGGTGGATCCAGG + Intergenic
969574520 4:8029259-8029281 CTGCAAGCTCATGTGGGTCTCGG - Intronic
969614078 4:8242272-8242294 TGGCAGAGCCAGGAGGGTCTGGG + Intergenic
970118567 4:12726797-12726819 CTTCAGACACATGTGGGTTTTGG - Intergenic
970155680 4:13139686-13139708 CAGCAGAGACAGGTGGCTCTTGG - Intergenic
973369625 4:49234988-49235010 CTGCAGCCCCAGATGGCTCCTGG - Intergenic
973391406 4:49560428-49560450 CTGCAGCCCCAGATGGCTCCTGG + Intergenic
981186671 4:141811568-141811590 CATCAGACCCAGGATGGTCTGGG + Intergenic
984771531 4:183440849-183440871 CTGCAGACATAGGTGTGGCTGGG - Intergenic
985558424 5:569464-569486 GTGCACACCCAGGTGGGGCCAGG + Intergenic
990995876 5:61731855-61731877 CCACAGAACCTGGTGGGTCTGGG - Intronic
992091648 5:73322947-73322969 CTGCAGACCCAGATGGCTACAGG + Intergenic
993095281 5:83472940-83472962 CTGCAGACAAAGGTGGCTCGGGG + Intronic
994872101 5:105364740-105364762 CTGCAAATCCATGTGGTTCTGGG - Intergenic
995145908 5:108787020-108787042 CTGCAGAGCCAGCAGGGGCTGGG + Intronic
995568652 5:113457194-113457216 CTGGAGTTCCAGGTGGGCCTGGG + Intronic
996485546 5:124029589-124029611 CTGCAGAATCAGGTGGGTGAAGG - Intergenic
996846859 5:127909191-127909213 ATACACACCCAGGTGGGTCTGGG + Intergenic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
1001568203 5:172714000-172714022 CTGCCCACCCAGGGGGCTCTGGG - Intergenic
1001741143 5:174053598-174053620 CTGAAGAACCAGGGGGCTCTAGG - Intronic
1002270850 5:178070960-178070982 CTGCAGACCCTGGGGGCCCTGGG + Intergenic
1002424948 5:179169466-179169488 CTCTGGACCCAGGTAGGTCTGGG + Intronic
1003264924 6:4557204-4557226 CTGCAGACCCAGGAGGAGTTGGG - Intergenic
1004886897 6:20060015-20060037 CATCAGACCCAGGTGGGTGTTGG + Intergenic
1006861628 6:37175186-37175208 CTACTTACCCAGGTGGGTCCCGG + Exonic
1007505085 6:42329377-42329399 CTCCAGTTCAAGGTGGGTCTTGG + Intronic
1007662665 6:43496273-43496295 CCACATACCCAGGTGGGTTTAGG + Intronic
1012095606 6:94954876-94954898 CTGTAGATCCAGTTGTGTCTGGG + Intergenic
1012643497 6:101651802-101651824 CTGAAGATCCAGTAGGGTCTGGG + Intronic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1016323144 6:142870115-142870137 CTGCAGACCCAGGTGGGTCTTGG - Intronic
1016837032 6:148487807-148487829 TTGCAGACCCAGGTGCGAGTCGG - Intronic
1016841912 6:148533500-148533522 CTGCAGAACCAGGGGTGCCTGGG - Intronic
1018701562 6:166431369-166431391 CTGCAGACTGAGGTGGGGCCTGG + Intronic
1018850894 6:167589422-167589444 CTGCGGACCCAGGTGGGAAGGGG + Intergenic
1018947125 6:168355831-168355853 CTGCAGAGCACGGTGGCTCTGGG - Intergenic
1019067657 6:169315923-169315945 GTGCAGACACAGGAGGGTGTTGG - Intergenic
1019306450 7:337590-337612 TTGCAGACACAGGTGGGCATGGG - Intergenic
1019479650 7:1260575-1260597 CTGCAGACCCAGACCGGCCTCGG + Intergenic
1019674896 7:2305037-2305059 CTGCAGACGCCGGAGGGTCTGGG + Intronic
1019802260 7:3096703-3096725 CTGTACACCCAGGTGGATTTTGG + Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023362053 7:39426906-39426928 ATGCAGCACCAGTTGGGTCTTGG + Intronic
1023889683 7:44383227-44383249 CTGGAGACCAAGGAGGGCCTTGG + Exonic
1023975543 7:45027152-45027174 CTCCATTCCCAGGTGGGGCTTGG - Intronic
1024727074 7:52210428-52210450 CTTCAGAATCAGGAGGGTCTGGG - Intergenic
1025247333 7:57327201-57327223 CTAAAGACCCAGGAGGGGCTGGG + Intergenic
1029444949 7:100606619-100606641 CTTCAGCCCCTGGTGAGTCTGGG + Exonic
1031629748 7:124032605-124032627 CTGCAGCCCCACGTGGGCCGAGG + Exonic
1032451385 7:132034893-132034915 CTGCAGAGCCAGGTGGGGTTGGG - Intergenic
1033657512 7:143383144-143383166 CTGGAGCCCCAGGTGGATCTGGG + Exonic
1033673997 7:143519772-143519794 CTGGAGACCTAGGAGGGGCTTGG + Intergenic
1034001643 7:147419794-147419816 CTGCAGACTCATGTGCTTCTTGG - Intronic
1034338017 7:150335828-150335850 CTGCAGGACCAGGTGAGTCCAGG - Intronic
1034958820 7:155351668-155351690 GTGCAGACCCAGGAGGGCCCTGG - Intergenic
1035205557 7:157291905-157291927 CTGCAGACCCGGGAGGGCCCCGG + Intergenic
1035580946 8:738660-738682 CTGCGCGCCCAGGTGGGGCTGGG + Intergenic
1035616917 8:1008946-1008968 CTGCATACCCAGGAGCCTCTGGG - Intergenic
1038639378 8:29311515-29311537 CTGGAGTTCCAGGTGGGTGTGGG + Intergenic
1038820037 8:30943663-30943685 CTGCAGACCCAGACGGTTCAAGG + Intergenic
1039304802 8:36249838-36249860 CTGGAGACCCAGGAGGGTTGTGG + Intergenic
1039382299 8:37097392-37097414 TTGCATACCCAGCTGGGTCTTGG - Intergenic
1042965518 8:74347879-74347901 TTGCAGACCCAAGTTGGTGTGGG + Intronic
1049229846 8:141476278-141476300 CTGCAGAGGCAGGTGGGCCAGGG - Intergenic
1051873673 9:21768089-21768111 CTGTTTACCCAGTTGGGTCTGGG + Intergenic
1054752851 9:68926170-68926192 CTGCAGCCCCTGGTGCGTTTTGG + Intronic
1057210396 9:93198177-93198199 CTGCAGGCTCCGGTGGTTCTGGG + Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1060155681 9:121318483-121318505 AAGCAGACTCAGGTGAGTCTTGG + Exonic
1060359369 9:122940847-122940869 CTGAAAGCCCAGGTGGGGCTCGG + Intronic
1060996718 9:127878163-127878185 GAGGAGTCCCAGGTGGGTCTCGG - Intergenic
1061231164 9:129316611-129316633 CTGGAGATCCAGGCGGGCCTTGG - Intergenic
1061521002 9:131117798-131117820 CTTCATCTCCAGGTGGGTCTTGG - Exonic
1061605147 9:131704405-131704427 TGGCAGGCCCAGGTGGGGCTGGG - Intronic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1061940354 9:133880598-133880620 GTGCAGTCCCTGATGGGTCTTGG + Intronic
1062004203 9:134231139-134231161 CTGCAGACACAGGCGGACCTGGG + Intergenic
1062067609 9:134537207-134537229 CTACAGAGCTGGGTGGGTCTGGG + Intergenic
1062081310 9:134625185-134625207 CTGCAGAGTCAGGAGGGCCTGGG - Intergenic
1062280567 9:135749929-135749951 CCTCAGACCCAGGAGGGTCCTGG - Intronic
1062416540 9:136454097-136454119 CTGCAGCCCCACCTGGGTCTGGG + Exonic
1062590956 9:137274463-137274485 CTGGGGACCCAGGTGAGGCTGGG + Intergenic
1062716293 9:138011868-138011890 CAGGGGAGCCAGGTGGGTCTGGG + Intronic
1203489574 Un_GL000224v1:90656-90678 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1203502196 Un_KI270741v1:32544-32566 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1185498515 X:578683-578705 CTCCAGACCCAGGTCTTTCTCGG - Intergenic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1187243546 X:17534421-17534443 TTGGAGACCTAGGTGGCTCTTGG + Intronic
1188934236 X:36153769-36153791 CAGCAGACCCAGGTGTGGCTTGG - Intergenic
1191255527 X:58278007-58278029 CGCCTGACCCAGGTGGGTCTTGG - Intergenic
1193946123 X:87737639-87737661 TTGCTTACCCAGTTGGGTCTAGG + Intergenic
1198012061 X:132567252-132567274 CTGCAGAGGCAGGTGGGTTGGGG + Intergenic
1199489546 X:148383132-148383154 CTGCAGAAGCAGGTGAGTCAGGG + Intergenic