ID: 1016324121

View in Genome Browser
Species Human (GRCh38)
Location 6:142880296-142880318
Sequence GGTGCAAGTTATGGGGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016324121_1016324125 -10 Left 1016324121 6:142880296-142880318 CCAACAACCCCATAACTTGCACC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1016324125 6:142880309-142880331 AACTTGCACCCTCCCCCAGATGG 0: 1
1: 0
2: 1
3: 5
4: 125
1016324121_1016324134 27 Left 1016324121 6:142880296-142880318 CCAACAACCCCATAACTTGCACC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1016324134 6:142880346-142880368 AAAAATTGACTCCAATGAGAAGG 0: 1
1: 0
2: 4
3: 31
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016324121 Original CRISPR GGTGCAAGTTATGGGGTTGT TGG (reversed) Intronic
903562499 1:24238368-24238390 GGTGCCAGTTGTGGGGTGGCGGG + Intergenic
906311738 1:44759265-44759287 GGTGCAAGTGGTGGGGCTGCAGG + Exonic
909989646 1:82207472-82207494 GGAGGAAGTTTTGGGGGTGTTGG + Intergenic
914680878 1:149937441-149937463 TGTGCAAGTCTTGGGGATGTGGG + Intergenic
920858836 1:209688258-209688280 AGTACAAGTTATGAGGATGTTGG - Intronic
924674908 1:246166030-246166052 GGTGTAGGTAATGGGGGTGTGGG - Intronic
1064808619 10:19167064-19167086 GGTTCAAGTTAAAGGGTTGGGGG + Intronic
1067430179 10:46237521-46237543 GGTGCCAGCTATGGGGTTCCAGG + Intergenic
1068420405 10:56784148-56784170 TGTGGAAGTTATAGGGTTTTTGG + Intergenic
1072693839 10:97589022-97589044 GGGGCAAATTCTGGGTTTGTAGG + Intronic
1073289678 10:102407280-102407302 GGAACAAATTAGGGGGTTGTGGG + Intronic
1074351201 10:112738786-112738808 GAGTCAAGTTATGGTGTTGTGGG + Intronic
1076821138 10:132940151-132940173 GTTGCAAGTGCTGGGGATGTAGG - Intronic
1076889623 10:133277216-133277238 GGGGCAAGTCATGGCTTTGTGGG + Intergenic
1079416739 11:20244855-20244877 GGTGCAAGTTCTAGAGTGGTTGG - Intergenic
1081346372 11:41991995-41992017 CGTGCACGTTTTGGGGATGTGGG - Intergenic
1088568375 11:111197013-111197035 GGTGCAAGAGACAGGGTTGTTGG - Intergenic
1090000895 11:122956847-122956869 TGTGTATGTTATGTGGTTGTTGG + Intronic
1090496555 11:127218341-127218363 GCTGCAAGTTATGTGGCTTTGGG - Intergenic
1091542422 12:1474086-1474108 GATTCAAGTTAGGGGCTTGTGGG + Intronic
1093852008 12:24051804-24051826 TTTGCAAGTAATGTGGTTGTTGG - Intergenic
1099501635 12:83420514-83420536 GGTGCCTGTTGTGGGGTTGGGGG - Intergenic
1100656065 12:96646941-96646963 GGGGCCTGTTATGGGGTGGTGGG + Intronic
1100906540 12:99306437-99306459 GGTGAAAGTTATGGGGGTGGGGG - Intronic
1104100536 12:125604435-125604457 GGGGCCAGTTGGGGGGTTGTGGG + Intronic
1105580118 13:21687829-21687851 GGGGACAGTTATGTGGTTGTGGG + Intronic
1105676713 13:22679704-22679726 GGTGAAGGTGATGGGGTGGTGGG - Intergenic
1107317262 13:39146492-39146514 GGTGAATGTTAAGGGGTTTTCGG + Intergenic
1109155984 13:58910159-58910181 GGTGCCAGTAATGGGGTAGGGGG + Intergenic
1109330917 13:60928660-60928682 GGTTCTTGTTATGGGGTCGTCGG + Intergenic
1109496677 13:63180877-63180899 GGGGCCTGTTGTGGGGTTGTGGG - Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1113905850 13:113818933-113818955 GGTGCCAGTTATGGGCTCCTCGG - Intergenic
1115792190 14:36892700-36892722 GGGGCCAGTTGTGGGGTTGGGGG - Intronic
1122348868 14:101076490-101076512 GTTCCAAGTTTTGGGGTTTTCGG - Intergenic
1123463484 15:20495660-20495682 GGTGCATGTTATGGTGTTGGTGG - Intergenic
1123654577 15:22504757-22504779 GGTGCATGTTATGGTGTTGGTGG + Intergenic
1124274326 15:28313068-28313090 GGTGCATGTTATGGTGTTGGTGG - Intronic
1124308488 15:28599954-28599976 GGTGCATGTTATGGTGTTGGTGG + Intergenic
1124813862 15:32968843-32968865 GGTGCAAGTCCTGGGGGTGGTGG + Exonic
1124941733 15:34224807-34224829 GGTGCACTTTATGGGGCTGAAGG - Intergenic
1125292483 15:38165182-38165204 GGTGTAGGGTTTGGGGTTGTGGG + Intergenic
1125385072 15:39128574-39128596 TGAGCAAGTTATGGGGTTCCTGG + Intergenic
1126668026 15:51092899-51092921 GGTTGAAGTTAAGGGGTTGAGGG - Intronic
1128649707 15:69401540-69401562 GTAGCAAGTTTTGGGGTTGCAGG + Intronic
1129332976 15:74837237-74837259 GGTGCAAGCTACGGGGGTGAGGG + Exonic
1134795187 16:17028803-17028825 GGTGCAAGCCATTGGGCTGTAGG + Intergenic
1135477020 16:22785820-22785842 GGTGGAAGTTGTTGGGTTATGGG - Intergenic
1140828790 16:78732149-78732171 GATTCAAGTTTTGGGGTTGGGGG - Intronic
1146255332 17:31388963-31388985 GGTGCAATTTATGGAGTCCTTGG - Intergenic
1147864638 17:43544598-43544620 GGTGCATGTTGGGGTGTTGTTGG - Intronic
1148349073 17:46926355-46926377 AGTGGATGTTATGGGGTGGTGGG + Intronic
1148443608 17:47724786-47724808 GCTGCAATTTAAGGGGTTGTGGG + Intergenic
1150325090 17:64250650-64250672 GGAGCAAGTTATGTTGTTGTAGG - Intronic
1150644638 17:66970288-66970310 GGGGCAGGTAAGGGGGTTGTTGG + Intronic
1151677120 17:75604340-75604362 CGTGCAGGTTCTGGGGATGTGGG - Intergenic
1152106766 17:78334656-78334678 AGTGCAAGTTATTGTGTTATAGG - Intergenic
1154217907 18:12428999-12429021 GGTGCAGGGGATGGGGTTGGGGG + Intronic
1155893836 18:31298679-31298701 GGGGCCAGTCATGGGGTTGGGGG + Intergenic
1156116619 18:33793835-33793857 GGTGCCTGTTGTGGGGTTGGGGG + Intergenic
1160270796 18:77381900-77381922 GGTGGAAGAAATGGGGTTATTGG + Intergenic
1160437784 18:78865121-78865143 GGTGAAAGCTATGGGAATGTGGG + Intergenic
1163466008 19:17469086-17469108 GGTGCAAGTAAAGGGCCTGTAGG + Intronic
1167563761 19:50243050-50243072 GGTGCGAGTTACGGTGCTGTTGG + Intronic
1168481624 19:56724814-56724836 GGAGCAGGTGATGGGGGTGTGGG + Intergenic
925360805 2:3278789-3278811 GTTGCCAGTTATGGGGTTGCTGG - Intronic
932912808 2:75822231-75822253 GCTGCAAGTGGTGGGGGTGTGGG - Intergenic
935179250 2:100675494-100675516 GGAGCAGGGTATGGGCTTGTGGG - Intergenic
936516017 2:113182150-113182172 GGTGCAAGTTTAGAGATTGTGGG + Intronic
940705221 2:157097409-157097431 GGGGCCAGTCATGGGGTTGGGGG - Intergenic
941449202 2:165639073-165639095 GGCATAAGTTATGGTGTTGTTGG - Intronic
942272600 2:174291936-174291958 GGTGCCTGTCGTGGGGTTGTGGG + Intergenic
944437859 2:199710331-199710353 GGTGTGAGTTATGGTGCTGTTGG + Intergenic
947352302 2:229258898-229258920 GGGGTAAGTTTTGGGGTTGACGG - Intronic
1170717497 20:18844628-18844650 GGTGCCACGTATGGGGTTGGGGG - Intergenic
1175042389 20:56066684-56066706 GGGGCAAGTTGTGGGGTGGGGGG - Intergenic
1175446294 20:59022364-59022386 GGTCCAAGTTATGGGCTGTTTGG + Intronic
1175873945 20:62220680-62220702 GGTGCATGTTTTGGGAATGTGGG + Intergenic
1176307172 21:5129807-5129829 GGTGGGAGCGATGGGGTTGTGGG + Intergenic
1179849887 21:44132223-44132245 GGTGGGAGCGATGGGGTTGTGGG - Intergenic
1180133807 21:45847006-45847028 GGAGCAAGTTATGTGGCAGTTGG - Intronic
1180750536 22:18121399-18121421 GGTGAATGTTATGGGGATGTAGG + Intronic
1181898633 22:26133442-26133464 GGGGCCTGTTATGGGGTTGGGGG + Intergenic
1182151182 22:28028227-28028249 GGTGCAAGCTCCGGGGCTGTGGG + Intronic
1183248717 22:36713165-36713187 GGTGCAAGTGAAGGAGGTGTTGG + Intergenic
1183271289 22:36864155-36864177 GGTGGAAGTTCAGAGGTTGTTGG - Intronic
952736562 3:36697277-36697299 GGGGGAAGCTGTGGGGTTGTGGG - Intergenic
956250206 3:67227659-67227681 GGATCAAATTAAGGGGTTGTAGG - Intergenic
957829505 3:85497736-85497758 GAGGAAGGTTATGGGGTTGTGGG + Intronic
960478951 3:118164241-118164263 GGGGCCAGTTGTGGGGTGGTGGG + Intergenic
961771444 3:129252953-129252975 CAGGCAAGTCATGGGGTTGTGGG + Exonic
962829993 3:139131396-139131418 AGTGCAGGTTATGGGGGAGTCGG + Intronic
963516761 3:146318368-146318390 GGGGCATGTTGTGGGGTTGGGGG - Intergenic
968434298 4:576707-576729 TGTGGAAGTTATGGGGATGCAGG + Intergenic
974749219 4:66114920-66114942 GGGGCCAGTTGTGGGGTTGGGGG + Intergenic
976926436 4:90503564-90503586 GGGGCCTGTTATGGGGTTGAGGG - Intronic
977751437 4:100614391-100614413 GGTGGAAGATATGGAGTTGGAGG - Intronic
987078303 5:14403936-14403958 GGTGCAGGTTGTGAGGGTGTAGG + Intronic
987265775 5:16253473-16253495 GGTGGGAGTTGTGGGGTTGTGGG + Intergenic
988072337 5:26308412-26308434 GGTGCCTGTTGTGGGGTTGGGGG + Intergenic
991998784 5:72415636-72415658 AGGGCGTGTTATGGGGTTGTTGG - Intergenic
993517005 5:88850087-88850109 GGGGCCTGTTATGGGGTTGGGGG - Intronic
993531727 5:89033607-89033629 GTAGTAAGTTATGGGGCTGTAGG + Intergenic
993871591 5:93260834-93260856 GGTGCCTGTCATGGGGTTGGGGG + Intergenic
999162868 5:149519590-149519612 GGTTCAACTTATGGGGTGATTGG - Intronic
999323065 5:150626518-150626540 GGTGTCAGTTGTGGGGTTGAGGG - Intronic
1000279352 5:159768762-159768784 AGGGCAAGTTATGGGGATGAGGG - Intergenic
1003694508 6:8389980-8390002 GGGGCAAGTTTTGGGGCTGAGGG + Intergenic
1003888313 6:10540822-10540844 GGTGGAAGTGATGGGGGAGTTGG - Intronic
1004477681 6:15988993-15989015 GGTGCAAGCTATGGGGTGGAGGG + Intergenic
1004827720 6:19441741-19441763 GGTGCAACATATGAGCTTGTGGG + Intergenic
1005863072 6:29916275-29916297 TGTGCAATTTATGATGTTGTGGG - Intergenic
1009237008 6:61135475-61135497 GGGGCCTGTTATGGGGTTGGGGG - Intergenic
1010586920 6:77665315-77665337 GGTGAAAGATAAGGGGTTGAGGG + Intergenic
1016324121 6:142880296-142880318 GGTGCAAGTTATGGGGTTGTTGG - Intronic
1017349722 6:153426181-153426203 GGTGCAGGTGATAGGGTAGTGGG + Intergenic
1017349994 6:153428847-153428869 GGTGCAGGTGATAGGGTAGTGGG + Intergenic
1020755758 7:12201275-12201297 GGTGACAGTTATAGGGTTGTGGG - Intergenic
1022782080 7:33596010-33596032 GGGGCCAGTCATGGGGTTGGAGG + Intronic
1023664888 7:42512882-42512904 GGTGCACATTGTGGGGTTGGGGG - Intergenic
1026384445 7:69832126-69832148 GGAGCAGGGTAGGGGGTTGTCGG - Intronic
1026638365 7:72103942-72103964 TGTGCAGGATATGGGCTTGTGGG + Intronic
1028529593 7:91824382-91824404 TGTGCTAGTTTTGGGTTTGTTGG + Intronic
1029730673 7:102435926-102435948 GGAGCAAGGTAAGGGGATGTGGG - Intronic
1036655390 8:10674220-10674242 GGGGTATGATATGGGGTTGTGGG - Intronic
1042515690 8:69656473-69656495 GGGGCTTGTTGTGGGGTTGTTGG - Intronic
1043930085 8:86081066-86081088 GGTGCAATTGATGGTGTTCTAGG - Intronic
1047948530 8:129907435-129907457 GGTGCCTGTTATGGGGTGGGGGG + Intronic
1048546722 8:135394517-135394539 GGAGCAAGTTTTGAGGTTGATGG - Intergenic
1049415445 8:142492858-142492880 GGTGGAAGTGCTGGGGCTGTGGG - Intronic
1049766589 8:144358066-144358088 GGTGCAGATTTTCGGGTTGTTGG - Exonic
1056786615 9:89597168-89597190 GGTGCAAGGTATAGGGTGGATGG - Intergenic
1058431958 9:104927813-104927835 GTTGCAAGTGGTGGGGATGTGGG + Intronic
1060103539 9:120859787-120859809 GATTCCAGTTCTGGGGTTGTTGG - Intronic
1187373958 X:18734280-18734302 GGGGCCTGTTATGGGGTTGGGGG - Intronic
1190172427 X:48122112-48122134 GGTGCTAGTAAGGAGGTTGTGGG + Intergenic
1198460064 X:136854562-136854584 GGTGTAAGTAATGAGGTTGCTGG - Intronic
1198660455 X:138962835-138962857 GGGGCCTGTGATGGGGTTGTGGG + Intronic