ID: 1016330103

View in Genome Browser
Species Human (GRCh38)
Location 6:142945960-142945982
Sequence GAGGAGGAGGAGAAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016330094_1016330103 10 Left 1016330094 6:142945927-142945949 CCGCGGCGGCCGCTCACCTGGAA No data
Right 1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG No data
1016330092_1016330103 18 Left 1016330092 6:142945919-142945941 CCTCGCAGCCGCGGCGGCCGCTC No data
Right 1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG No data
1016330097_1016330103 -6 Left 1016330097 6:142945943-142945965 CCTGGAAAGTCACCGCTGAGGAG No data
Right 1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG No data
1016330095_1016330103 1 Left 1016330095 6:142945936-142945958 CCGCTCACCTGGAAAGTCACCGC No data
Right 1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016330103 Original CRISPR GAGGAGGAGGAGAAGGAGGA CGG Intergenic
No off target data available for this crispr