ID: 1016335995

View in Genome Browser
Species Human (GRCh38)
Location 6:143005748-143005770
Sequence TAATCTATGCCACCTGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016335995_1016335997 -5 Left 1016335995 6:143005748-143005770 CCTGTGACAGGTGGCATAGATTA No data
Right 1016335997 6:143005766-143005788 GATTAAAGTCTGAGGACTAGTGG No data
1016335995_1016335998 -1 Left 1016335995 6:143005748-143005770 CCTGTGACAGGTGGCATAGATTA No data
Right 1016335998 6:143005770-143005792 AAAGTCTGAGGACTAGTGGCAGG No data
1016335995_1016335999 0 Left 1016335995 6:143005748-143005770 CCTGTGACAGGTGGCATAGATTA No data
Right 1016335999 6:143005771-143005793 AAGTCTGAGGACTAGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016335995 Original CRISPR TAATCTATGCCACCTGTCAC AGG (reversed) Intergenic