ID: 1016337137

View in Genome Browser
Species Human (GRCh38)
Location 6:143018955-143018977
Sequence GCCACCTGGAGAAAAACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016337137_1016337143 24 Left 1016337137 6:143018955-143018977 CCTTGGGTTTTTCTCCAGGTGGC No data
Right 1016337143 6:143019002-143019024 GAAGTCTCTCATTCCACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016337137 Original CRISPR GCCACCTGGAGAAAAACCCA AGG (reversed) Intergenic
No off target data available for this crispr