ID: 1016337581

View in Genome Browser
Species Human (GRCh38)
Location 6:143024192-143024214
Sequence TTCCAGACAGATTTCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016337581_1016337585 6 Left 1016337581 6:143024192-143024214 CCCACCAGGAAATCTGTCTGGAA No data
Right 1016337585 6:143024221-143024243 CAAGCTCCTAGGTTTCTGAGAGG No data
1016337581_1016337584 -5 Left 1016337581 6:143024192-143024214 CCCACCAGGAAATCTGTCTGGAA No data
Right 1016337584 6:143024210-143024232 TGGAAGAAAAACAAGCTCCTAGG No data
1016337581_1016337587 19 Left 1016337581 6:143024192-143024214 CCCACCAGGAAATCTGTCTGGAA No data
Right 1016337587 6:143024234-143024256 TTCTGAGAGGAAAACCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016337581 Original CRISPR TTCCAGACAGATTTCCTGGT GGG (reversed) Intergenic
No off target data available for this crispr