ID: 1016337610

View in Genome Browser
Species Human (GRCh38)
Location 6:143024499-143024521
Sequence GCCAGTCAGTCCCAAATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016337610_1016337614 2 Left 1016337610 6:143024499-143024521 CCTGTAATTTGGGACTGACTGGC No data
Right 1016337614 6:143024524-143024546 ACTTGGTAGCTTTTAGTATGGGG No data
1016337610_1016337612 0 Left 1016337610 6:143024499-143024521 CCTGTAATTTGGGACTGACTGGC No data
Right 1016337612 6:143024522-143024544 TAACTTGGTAGCTTTTAGTATGG No data
1016337610_1016337615 15 Left 1016337610 6:143024499-143024521 CCTGTAATTTGGGACTGACTGGC No data
Right 1016337615 6:143024537-143024559 TAGTATGGGGTCAAACCTAATGG No data
1016337610_1016337616 16 Left 1016337610 6:143024499-143024521 CCTGTAATTTGGGACTGACTGGC No data
Right 1016337616 6:143024538-143024560 AGTATGGGGTCAAACCTAATGGG No data
1016337610_1016337613 1 Left 1016337610 6:143024499-143024521 CCTGTAATTTGGGACTGACTGGC No data
Right 1016337613 6:143024523-143024545 AACTTGGTAGCTTTTAGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016337610 Original CRISPR GCCAGTCAGTCCCAAATTAC AGG (reversed) Intergenic
No off target data available for this crispr