ID: 1016340866

View in Genome Browser
Species Human (GRCh38)
Location 6:143060632-143060654
Sequence ACGCAGGAGCAGAATGACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016340862_1016340866 -8 Left 1016340862 6:143060617-143060639 CCCGGGACCCTGCGAACGCAGGA 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1016340851_1016340866 28 Left 1016340851 6:143060581-143060603 CCTGGGATGCCTAGGGGGCGCCT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1016340863_1016340866 -9 Left 1016340863 6:143060618-143060640 CCGGGACCCTGCGAACGCAGGAG 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1016340853_1016340866 19 Left 1016340853 6:143060590-143060612 CCTAGGGGGCGCCTCCTGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1016340860_1016340866 0 Left 1016340860 6:143060609-143060631 CCGGGTGTCCCGGGACCCTGCGA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1016340859_1016340866 5 Left 1016340859 6:143060604-143060626 CCTGGCCGGGTGTCCCGGGACCC 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1016340858_1016340866 8 Left 1016340858 6:143060601-143060623 CCTCCTGGCCGGGTGTCCCGGGA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016340866 Original CRISPR ACGCAGGAGCAGAATGACGA AGG Intronic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
903364700 1:22798833-22798855 AGGCAGGAGCAGGATGAGAAGGG + Intronic
905229810 1:36508013-36508035 AAACAGGAGCAGAATGATGTAGG - Intergenic
907388939 1:54144048-54144070 ACACAGGACAAGAATGACAAGGG + Exonic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
914447903 1:147765660-147765682 AGGCAGGAGCAGATTGTGGAGGG + Intronic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
922566771 1:226606220-226606242 ACGCTGGTGCAGAAAGACCAGGG - Exonic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063881338 10:10535788-10535810 CCACAGGAGCAGAATGGGGAGGG + Intergenic
1064709312 10:18107474-18107496 ATGCAAGAGCAGACTGAAGAGGG - Intergenic
1069703440 10:70442090-70442112 AAGCAGGAAGAGAATGCCGAGGG + Intronic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1070159372 10:73856596-73856618 AGGCAGGAGCAGAGGGACTATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1080172073 11:29316441-29316463 TCGCAGTAGGAGAATGACCAAGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1084098378 11:66928447-66928469 TGGCAGCAGCAGAATGACCATGG + Intronic
1085107820 11:73861289-73861311 AAGCAGGAGGAGAATCATGAAGG - Intronic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1089999024 11:122937720-122937742 ACGAAGGAGAAGAGTGAAGAGGG - Intronic
1092503831 12:9074579-9074601 ACGAAGCAGCAGAATGCCCAGGG - Exonic
1093832610 12:23782394-23782416 ATGCAGAAGCAGAATGACTGTGG + Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1104431817 12:128722655-128722677 ACACAGGAGCAGCATGAAAATGG - Intergenic
1105636215 13:22217995-22218017 ACACAGCAGCAGAATGCAGAGGG + Intergenic
1109781445 13:67115415-67115437 ACCCAGGAGCAGAAGGATGAAGG + Intronic
1110036399 13:70690797-70690819 ACTCAGTAGCAGAAGGAAGAGGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1121003136 14:90466232-90466254 CCACAGGAGAAGAATGACCAAGG + Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1131035606 15:89220045-89220067 ATGCAGGAGCAGGATGGTGAAGG - Intronic
1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG + Intronic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1138221448 16:55255136-55255158 ACACAGGGGCAGAATGACTGAGG + Intergenic
1145248139 17:21283358-21283380 ACGCAGGAAGAGAATGGTGATGG + Intergenic
1145249698 17:21290332-21290354 AGGCAAGAGCAGAATGACAAGGG - Intronic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1149461676 17:56834189-56834211 GCGCAGGAGGAGAACGACGCTGG - Exonic
1150339792 17:64357237-64357259 ACCCAGGAGGAGAATGGGGATGG - Intronic
1156472285 18:37384766-37384788 ACTCATGAGCAGAATGGCTAAGG + Intronic
1160469238 18:79113604-79113626 ACACAGGTGCAGAATGACCAAGG - Intronic
1161541008 19:4851621-4851643 ATGCAGGAGCGGAGTGGCGAAGG + Intronic
1162174932 19:8823553-8823575 AGGCAGGAGCAGGGTGACCAAGG - Intronic
1164641792 19:29831761-29831783 GCACAGGAGCAGAATCACGGGGG - Intergenic
1165140791 19:33698838-33698860 ACGCAGGTGCAGAGGGGCGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
928196515 2:29220277-29220299 TGGCAGGAGCAGAATGAAGGGGG - Intronic
930965212 2:57314853-57314875 ACCCAGGAGTAGAATGGTGAGGG + Intergenic
933344976 2:81071855-81071877 ACCCAGTAGCAGAATGGAGAGGG + Intergenic
934517781 2:94999514-94999536 AGGCAGGCGCAGAATGAGGCAGG + Intergenic
936489934 2:112961271-112961293 AGGCAGCATCAGAATGACGCTGG - Intergenic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
938077568 2:128347854-128347876 ACGCAGGATCAGACAGACGTAGG - Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
940164050 2:150748370-150748392 AAGAAGGAGGAGAAGGACGAGGG - Intergenic
940312542 2:152293751-152293773 AGGCAGGAGCATAATGATGAAGG - Intergenic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
946335701 2:219034990-219035012 ACGCAGGAGTAGAATTGCGGAGG - Intronic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172276805 20:33684536-33684558 ACTCAAGAGCAGAATGACATGGG + Intronic
1172517941 20:35548618-35548640 ATGCAGGAGCAGAAGAATGAAGG + Exonic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1184653640 22:45930638-45930660 AGGCAGGAGCAGCCTGAGGAAGG - Intronic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
1203294700 22_KI270736v1_random:30729-30751 AGGCAGGATTAGAAAGACGAGGG - Intergenic
962753087 3:138449046-138449068 AGGCAGCAACAGAATGACCAAGG - Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
978965118 4:114731398-114731420 ACTCAGGATCAGGATGACAAAGG + Intergenic
984881386 4:184412737-184412759 AGGGAGGAAGAGAATGACGATGG - Intronic
992388656 5:76310462-76310484 TGGCTGGAGCAGAATGACCAAGG + Intronic
998384664 5:141749885-141749907 TCACAGGAGCAGAAAGAAGAAGG - Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1026807034 7:73435116-73435138 GCGCAGGGTCAGGATGACGATGG - Exonic
1030176852 7:106662573-106662595 ATGCATAAGTAGAATGACGAAGG + Intergenic
1031745733 7:125495533-125495555 AGGGAGGTGCAGAATTACGAGGG - Intergenic
1037463249 8:19134662-19134684 ACCCAGGAGCAAAACGACAATGG - Intergenic
1039854007 8:41397171-41397193 AAGAAGGAGCAGCAAGACGAAGG + Intergenic
1042766449 8:72327223-72327245 ACTCAGGAGAAGAATGGAGAAGG - Intergenic
1046834415 8:118783419-118783441 ACCCAGGAGCATAATGATTAAGG - Intergenic
1047062960 8:121248782-121248804 AAGAAGGAGCAGAAGGACAAAGG - Intergenic
1047236817 8:123048900-123048922 AGGCTGGAGCAGAGTGACAAGGG - Intronic
1049368159 8:142250846-142250868 ACGCAGGAGCCGACGGACGAGGG + Intronic
1051975712 9:22945945-22945967 ACAAGGGAGCAGAATGAAGAAGG - Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1056937949 9:90932152-90932174 ATTCAGGAACAGAATGAAGAGGG + Intergenic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1200044664 X:153394996-153395018 AGGCAGGCGCAGAATGAAGTGGG - Intergenic