ID: 1016345323

View in Genome Browser
Species Human (GRCh38)
Location 6:143106816-143106838
Sequence ATCTGTAAGTACCTTTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1182
Summary {0: 1, 1: 0, 2: 13, 3: 144, 4: 1024}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016345323_1016345328 29 Left 1016345323 6:143106816-143106838 CCAAGATAAAGGTACTTACAGAT 0: 1
1: 0
2: 13
3: 144
4: 1024
Right 1016345328 6:143106868-143106890 GCTTCCTAGTTCATAGACAGTGG No data
1016345323_1016345325 -1 Left 1016345323 6:143106816-143106838 CCAAGATAAAGGTACTTACAGAT 0: 1
1: 0
2: 13
3: 144
4: 1024
Right 1016345325 6:143106838-143106860 TTCCTTGTCTGATGAGGACAAGG 0: 1
1: 0
2: 1
3: 28
4: 242
1016345323_1016345324 -7 Left 1016345323 6:143106816-143106838 CCAAGATAAAGGTACTTACAGAT 0: 1
1: 0
2: 13
3: 144
4: 1024
Right 1016345324 6:143106832-143106854 TACAGATTCCTTGTCTGATGAGG 0: 1
1: 0
2: 7
3: 71
4: 456
1016345323_1016345327 7 Left 1016345323 6:143106816-143106838 CCAAGATAAAGGTACTTACAGAT 0: 1
1: 0
2: 13
3: 144
4: 1024
Right 1016345327 6:143106846-143106868 CTGATGAGGACAAGGAATGATGG 0: 1
1: 0
2: 2
3: 17
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016345323 Original CRISPR ATCTGTAAGTACCTTTATCT TGG (reversed) Intronic
900728478 1:4235086-4235108 ATCTGCCAGCACCTTGATCTTGG + Intergenic
900855120 1:5175191-5175213 ATCTGCCAGGACCTTGATCTTGG + Intergenic
900893135 1:5464084-5464106 ATCTGCCAGCACCTTGATCTTGG + Intergenic
901145803 1:7063969-7063991 ATCTGCCAGTGCCTTAATCTTGG - Intronic
901442099 1:9284086-9284108 ATCTGCCAGCACCTTCATCTTGG + Intergenic
901558760 1:10052867-10052889 ATCTCTTAGCACCTTGATCTTGG - Intronic
902115153 1:14115120-14115142 ATCTGCAGGTACCTTGCTCTTGG - Intergenic
902147181 1:14412314-14412336 ATATGTGAGTACTTTTATTTTGG - Intergenic
904367871 1:30027898-30027920 ATCTGCAGGTTCCTTGATCTTGG + Intergenic
905049131 1:35033927-35033949 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
905350190 1:37340190-37340212 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
905426897 1:37892967-37892989 ATCTGCCAGCACCTTGATCTTGG + Intronic
905538888 1:38744671-38744693 ATCTACCAGCACCTTTATCTTGG + Intergenic
905955008 1:41985400-41985422 ATCTGCCAGCACCTTGATCTTGG - Intronic
906072526 1:43027425-43027447 ATCAGTTGGTACCTTGATCTTGG + Intergenic
907617026 1:55936072-55936094 CTCTGCCAGTACCTTCATCTTGG - Intergenic
907709459 1:56865322-56865344 ATCTGCCAGTGCCTTGATCTTGG - Intronic
907869415 1:58429892-58429914 ATTTGCAAGCACCTTGATCTTGG - Intronic
907899331 1:58723137-58723159 ATCTGCCAGCACCTTGATCTCGG - Intergenic
908064794 1:60391111-60391133 ATCTGCCAGAACCTTGATCTTGG + Intergenic
908089604 1:60671892-60671914 ATCCGCCAGTACCTTGATCTTGG + Intergenic
908261181 1:62340322-62340344 ATCTGCCAGCACCTTGATCTTGG - Intergenic
908341034 1:63179345-63179367 ATCTGCTGGTACCTTGATCTTGG + Intergenic
908454652 1:64291389-64291411 ATCTGTCAGCACTTTGATCTTGG - Intergenic
908486479 1:64599121-64599143 ATCTGCCAGTACCTTAATCATGG + Intronic
908564728 1:65342488-65342510 ATCTGCAGGCACCTTGATCTTGG + Intronic
909166852 1:72237415-72237437 ATCTGTTGGTGCCTTTATGTTGG - Intronic
909171207 1:72298416-72298438 ACCTGTAAGCACATTGATCTTGG - Intergenic
909207561 1:72778911-72778933 ATCTGTCAGTGCCTTGATCTTGG - Intergenic
909311869 1:74161071-74161093 AACTGCCAGTAGCTTTATCTTGG - Intronic
909763182 1:79320220-79320242 ATCTGTCAGCACCTTGATCTTGG - Intergenic
909765342 1:79349094-79349116 ATCTGTCAGCACCTTGATCTTGG - Intergenic
909878822 1:80847368-80847390 ATCTGCCAGTGCCTTTGTCTTGG - Intergenic
910315511 1:85878232-85878254 ATCTGCCAGCACCTTGATCTTGG - Intronic
910442719 1:87268981-87269003 ATCTGTTGGCACCTTGATCTTGG + Intergenic
910445883 1:87298681-87298703 ATCTGTAGGTGCATTGATCTTGG + Intergenic
910952869 1:92669892-92669914 ATTTGTATGTAGCTATATCTAGG - Intronic
911003710 1:93195758-93195780 AACTGCCAGTACCTTGATCTTGG + Intronic
911228523 1:95334361-95334383 ATCTGCCAGCACCTTGATCTGGG - Intergenic
911532090 1:99055530-99055552 ATCTATGTGTATCTTTATCTGGG - Intergenic
911593950 1:99779815-99779837 ATCTGATAGCACCTTCATCTTGG + Intergenic
911687270 1:100791950-100791972 ATCTGCTAGTTCCTTGATCTTGG - Intergenic
911895057 1:103422861-103422883 ATCTGTTGGCACCTTAATCTTGG + Intergenic
912092084 1:106091036-106091058 ATCTGCTAGCACCTTGATCTTGG + Intergenic
912186498 1:107282869-107282891 ATCTGTCAGCACCTTTATCTTGG - Intronic
912351031 1:109013186-109013208 ATCTGCTGGTACCTTGATCTTGG + Intronic
912941430 1:114048628-114048650 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
913138816 1:115919527-115919549 ATCTGCTAGCACCTTGATCTTGG - Intergenic
913408521 1:118523104-118523126 ATCTCTGAGTTGCTTTATCTGGG + Intergenic
913464813 1:119129267-119129289 ATGTGTCAGCACCTTGATCTTGG + Intronic
913581345 1:120230395-120230417 ATCTGCCAGCACCTTGATCTTGG - Intergenic
913626831 1:120667996-120668018 ATCTGCCAGCACCTTGATCTTGG + Intergenic
913677250 1:121152345-121152367 AGCTGTCAGCACCTTTATCTTGG + Intergenic
914029087 1:143939974-143939996 AGCTGTCAGCACCTTTATCTTGG + Intergenic
914160364 1:145127976-145127998 AGCTGTCAGCACCTTTATCTTGG - Intergenic
914563277 1:148841838-148841860 ATCTGCCAGCACCTTGATCTTGG - Intronic
914609550 1:149288385-149288407 ATCTGCCAGCACCTTGATCTTGG + Intergenic
915715994 1:157945719-157945741 ATCTGCTAGCACCTTGATCTTGG + Intergenic
916105312 1:161425640-161425662 ATGTGCAAGCACCTTGATCTTGG + Intergenic
916118620 1:161509193-161509215 AGCTGTAAGCACCTTGATCTTGG + Intronic
916247578 1:162704550-162704572 ATCTGCCAGCACCTTGATCTTGG - Intronic
916689633 1:167178132-167178154 ATCTGCCAGCACCTTGATCTTGG - Intergenic
917255992 1:173116761-173116783 ATGTGCCAGTACCTTGATCTTGG + Intergenic
917724825 1:177818393-177818415 TTCTGTATCTACCCTTATCTGGG - Intergenic
917986816 1:180328204-180328226 ATATGTATGTATCTTAATCTAGG - Intronic
918636334 1:186779231-186779253 ATCTGTCAGTACCTTGATCTTGG - Intergenic
919539884 1:198833135-198833157 ATCTGCTGGTACCTTTATCTTGG + Intergenic
920028380 1:203018722-203018744 ACCTGCAAGTACCTTGATCTTGG - Intronic
920150750 1:203905496-203905518 ATCTGCCAGAACCTTTATCTGGG - Intergenic
920243400 1:204570256-204570278 ATCTGCCAGCACCTTGATCTTGG - Intergenic
920429508 1:205908046-205908068 ATCTGCCAGCACCTTGATCTTGG - Intergenic
920464554 1:206170861-206170883 AGCTGTCAGCACCTTTATCTTGG + Intergenic
920834360 1:209495127-209495149 ATCTGCCAGCACCTTGATCTTGG - Intergenic
921421351 1:214952209-214952231 ATCTGCTAGCACCTTGATCTTGG + Intergenic
921502203 1:215918494-215918516 ATCTGTCAGCACCTTGATCCTGG + Intronic
921990333 1:221359316-221359338 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922070744 1:222190716-222190738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922253942 1:223875170-223875192 ATCTGCCAGTGCCTTCATCTTGG + Intergenic
922529758 1:226335483-226335505 ATCTGCCAGTGCCTTGATCTAGG + Intergenic
922821784 1:228489662-228489684 ATCTGCCAGTTCCTTCATCTTGG - Intronic
922929396 1:229377041-229377063 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922930785 1:229387668-229387690 ATCTGTTCGTGCCTTGATCTTGG - Intergenic
922975489 1:229780213-229780235 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
923091640 1:230745534-230745556 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
923155800 1:231278486-231278508 CTATGCAAGTACCTTGATCTGGG - Intergenic
923315901 1:232779796-232779818 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
923951580 1:238961758-238961780 ATGTGTAAGTTCCTTTTTATTGG + Intergenic
923965013 1:239127702-239127724 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
924072640 1:240297838-240297860 ATCTGCCAGTGCCTTCATCTTGG - Intronic
1063168797 10:3487342-3487364 ATCTGCCAGAACCTTGATCTGGG + Intergenic
1063343643 10:5292268-5292290 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1063360613 10:5453581-5453603 ATCTGTAAGAAACTGTATCTGGG - Intronic
1063518919 10:6723150-6723172 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1063992010 10:11576600-11576622 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1064318213 10:14277502-14277524 ATCTGCCAGTACCTTGATCTTGG + Intronic
1064643636 10:17438335-17438357 ATTTGTAAATAAATTTATCTAGG - Intronic
1064801739 10:19082924-19082946 ATCTGCCAGTGCCTTGATCTTGG - Intronic
1064937719 10:20697186-20697208 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1064950457 10:20843254-20843276 ATCTGCCAGCACCTTGATCTTGG + Intronic
1065851911 10:29797308-29797330 ATCTGTCAGTGCCTTCATCTTGG + Intergenic
1066232556 10:33451094-33451116 ATCTGTCAATGCCTTGATCTTGG - Intergenic
1066298537 10:34076715-34076737 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1066480133 10:35787591-35787613 ATCTACCAGTACCTTGATCTTGG - Intergenic
1066515083 10:36149730-36149752 ATATGTAAGCACCTTGATCTTGG - Intergenic
1066535327 10:36384599-36384621 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1066611286 10:37250764-37250786 ATCTGCCAGTTCCTTCATCTTGG + Intronic
1067018558 10:42775630-42775652 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1067108805 10:43384057-43384079 ATCTCCAAGCACCTTTGTCTTGG + Intergenic
1067221218 10:44345719-44345741 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1067259473 10:44675651-44675673 ATCTGTCTGCACCTTGATCTTGG + Intergenic
1067794279 10:49309448-49309470 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1068003793 10:51369286-51369308 ATCTGTCAATGCCTTGATCTTGG - Intronic
1068207428 10:53873957-53873979 ATCTATTAGCACCTTGATCTTGG + Intronic
1068288437 10:54970177-54970199 ACCTGCTAGTACCTTTATCTTGG + Intronic
1068293379 10:55034029-55034051 ACCTGTCAGTTCCTTGATCTTGG + Intronic
1068295235 10:55062318-55062340 ATCTGCTGTTACCTTTATCTTGG + Intronic
1068345845 10:55776675-55776697 ATATGTGAGCACCTTGATCTTGG + Intergenic
1068391446 10:56402458-56402480 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
1068517069 10:58038140-58038162 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1068527356 10:58145207-58145229 ATCTGCCAGCACCTTCATCTGGG + Intergenic
1068902662 10:62287417-62287439 ACCTGCTAGTACCTTGATCTTGG - Intergenic
1070104781 10:73421175-73421197 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1070338298 10:75474367-75474389 ATCTGCCAGTCCCTTGATCTTGG - Intronic
1070530123 10:77329507-77329529 ATCAGTTAGCACCTTGATCTTGG + Intronic
1071262660 10:83934983-83935005 ATCTGTTGGCACCTTGATCTTGG - Intergenic
1071679977 10:87695182-87695204 ATCTGTAAGTTCCTTGCTCTTGG - Intronic
1072068797 10:91896660-91896682 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1072100180 10:92221941-92221963 ATCAGCTAGTGCCTTTATCTTGG + Intronic
1072156013 10:92724328-92724350 ATCTGTCGGTACCTTGACCTTGG - Intergenic
1072288565 10:93940890-93940912 ATCTGCTAGTGCCTTGATCTTGG + Intronic
1072619567 10:97070732-97070754 ATCTGCCAATACCTTGATCTTGG + Intronic
1073824915 10:107309480-107309502 ATCTGCAGGCACCTTAATCTTGG + Intergenic
1073973235 10:109069191-109069213 ATCTGTCAGTGCTTTAATCTTGG - Intergenic
1073983226 10:109178378-109178400 ATCTGCCAGCACCTTTATATCGG + Intergenic
1074105278 10:110384618-110384640 GTCTGTGAGCACCTTGATCTTGG - Intergenic
1074407104 10:113188950-113188972 ATCTGCTAGCACCTTGATCTTGG - Intergenic
1074431941 10:113401745-113401767 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1074897179 10:117787337-117787359 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1074972293 10:118549047-118549069 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1075161847 10:120031190-120031212 ATCTGTCTGTGCCTTGATCTTGG + Intergenic
1075196408 10:120363077-120363099 ATCTGCCAGTACCTTGATTTTGG + Intergenic
1075570430 10:123538002-123538024 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1075601321 10:123771542-123771564 ATCTGCCAGTAACTTGATCTTGG + Intronic
1075613551 10:123874193-123874215 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1075625260 10:123959575-123959597 ATCTGCTGGTGCCTTTATCTTGG + Intergenic
1076058549 10:127395248-127395270 ATCTGTGAGTGCCTTGATCTAGG - Intronic
1077278166 11:1727386-1727408 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1077869963 11:6253509-6253531 ATGTGTTGGTACCTTGATCTGGG - Intergenic
1077998938 11:7477250-7477272 ATCTGCCAGCACCTTCATCTTGG + Intergenic
1078267100 11:9763539-9763561 ATCTGTTAGTGCCTTAATTTTGG + Intergenic
1078499008 11:11850810-11850832 ATCTGCCGGCACCTTTATCTTGG - Intronic
1078887171 11:15513054-15513076 ATCTCTTAGCACCTTGATCTTGG + Intergenic
1078961954 11:16286020-16286042 ATTTGTGAGTACTTTTACCTTGG - Intronic
1080238704 11:30101643-30101665 ATATGTCAGTGCCTTCATCTTGG - Intergenic
1080303463 11:30811252-30811274 ATCTGTCAGTAACTTTTTCAGGG + Intergenic
1080695498 11:34600108-34600130 ATATCTAAGTACATTTTTCTAGG + Intergenic
1080766317 11:35300573-35300595 ATCTGCTAGTACCTTGATCTTGG + Intronic
1080848912 11:36050844-36050866 ATCTGTCAGTGCCTTGGTCTTGG - Intronic
1081150446 11:39622849-39622871 ATCTGCTAGGACCTTGATCTTGG - Intergenic
1081366459 11:42241272-42241294 ATCTGCTGGCACCTTTATCTTGG - Intergenic
1081598955 11:44478854-44478876 ATCTGTGAGGGCCTTGATCTTGG + Intergenic
1082008879 11:47437361-47437383 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1083354584 11:62056691-62056713 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1083355511 11:62063292-62063314 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1084222053 11:67688201-67688223 ATCAGTCAGCACCTTGATCTTGG + Intergenic
1084735519 11:71102926-71102948 ATCTGCCAGCACCTTGATCTTGG - Intronic
1085024518 11:73228805-73228827 ATTTGTAAGTAACTTGATCAAGG + Intronic
1085074563 11:73578979-73579001 ATCTGCTAGTACCTTGATCTTGG - Intronic
1085664650 11:78403076-78403098 ATGTGTCAGTGCCTTGATCTTGG + Intronic
1085736360 11:79042558-79042580 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1085798959 11:79569771-79569793 ATCTGTCAGCACCTTGATTTTGG + Intergenic
1085830008 11:79889609-79889631 ATCTGTTAGTGCCTTGATCTTGG + Intergenic
1085873525 11:80379437-80379459 ATCCGTCAGCACCTTCATCTTGG - Intergenic
1086416264 11:86591553-86591575 ACCTGTCAGTATCTTGATCTTGG + Intronic
1086744726 11:90410776-90410798 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1086758598 11:90597358-90597380 ATCTGACAATACCTTTATTTTGG - Intergenic
1086859752 11:91911271-91911293 ATCTGTCTCTACCTTAATCTTGG + Intergenic
1086859963 11:91914602-91914624 ATCTGCACGTGCCTTGATCTTGG - Intergenic
1087215502 11:95488716-95488738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1087476455 11:98641681-98641703 ATCTTTCAGTACCTTGATCTTGG - Intergenic
1087735370 11:101827043-101827065 ATCTGCCAGTTCCTTGATCTTGG - Intronic
1087868010 11:103257262-103257284 ATCTGTTGGCACCTTGATCTTGG + Intronic
1087978150 11:104575983-104576005 ATCTGTTATTGCCTTGATCTTGG + Intergenic
1088112993 11:106283192-106283214 ATCTGCAGGCACCTTCATCTTGG + Intergenic
1088361021 11:108990112-108990134 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1088364166 11:109021356-109021378 ATCTGTTTGCACCTTGATCTTGG - Intergenic
1088724919 11:112625625-112625647 ATCTTGTAGCACCTTTATCTTGG + Intergenic
1089009505 11:115121068-115121090 ATCTGCCAGTGCCTTTATCTTGG + Intergenic
1089071930 11:115707296-115707318 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1089731102 11:120519493-120519515 ATCTGCCAGCACCTTGATCTCGG + Intronic
1090283593 11:125479761-125479783 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1090345429 11:126065422-126065444 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1090433415 11:126665642-126665664 ATCTGCCAGCACCTTGATCTTGG + Intronic
1090450104 11:126798560-126798582 ATTTGTAAGTACATTTAGCCTGG + Intronic
1090543090 11:127730567-127730589 ACCTGTAAACACCTTGATCTTGG - Intergenic
1090912378 11:131132704-131132726 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1091022103 11:132109435-132109457 ATCTGCCAGCACCTTAATCTTGG + Intronic
1091029412 11:132171371-132171393 ATCTGCCAGAACCTTGATCTCGG - Intronic
1091155147 11:133365337-133365359 ATCTGCCAGTGCCTTGATCTTGG - Intronic
1092581976 12:9851674-9851696 ATTTGTAACTACATTTATCTAGG + Intergenic
1092946414 12:13458141-13458163 ATCTCCAAGTACTTATATCTAGG - Intergenic
1093030949 12:14288000-14288022 ATCTGTTGATGCCTTTATCTTGG - Intergenic
1093070366 12:14701948-14701970 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1093297948 12:17415367-17415389 ATCTGTTGGTACCTTTGTCTTGG - Intergenic
1093378057 12:18455612-18455634 ATCTGCTGGTACCTTGATCTTGG - Intronic
1093559939 12:20526279-20526301 CTCTGTAAGTATCTTTTTATTGG + Intronic
1093726099 12:22510346-22510368 ATCAGCATGTAACTTTATCTAGG - Intronic
1093794662 12:23297224-23297246 ATCTGCTAGCACCTTGATCTTGG - Intergenic
1094254260 12:28403396-28403418 ATCTGCAGGTACCTTGATCTTGG - Intronic
1094306081 12:29020674-29020696 ATCTGTAAGGGCATTTATCCTGG + Intergenic
1095222988 12:39640328-39640350 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1095453853 12:42361272-42361294 ATCTGCTGGTACCTTGATCTTGG + Intronic
1095664060 12:44774154-44774176 ATCTGTAACTACCCTTAACTGGG - Intronic
1095924872 12:47568480-47568502 ATCTGCTAGCACCTTAATCTTGG - Intergenic
1095931607 12:47631897-47631919 ATCTGCCAGTACCTTGATCTTGG - Intergenic
1096038167 12:48491208-48491230 ATCTGTTGGCACCTTGATCTAGG - Intronic
1096335202 12:50749978-50750000 AACTGTCAGCACCTTAATCTTGG + Intergenic
1097210439 12:57364509-57364531 ATCTGTGAACACCTTGATCTTGG - Intronic
1097630449 12:62055183-62055205 ATCTGCCAGCACCTTGATCTTGG + Intronic
1097849543 12:64397980-64398002 ATCTGTCAGCACCTTGATCATGG - Intergenic
1097949124 12:65406946-65406968 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1097960564 12:65528280-65528302 ATTTGTCAGCACCTTTATCTAGG + Intergenic
1098111141 12:67123096-67123118 ATCTGCCAATACCTTGATCTTGG - Intergenic
1098156007 12:67599461-67599483 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
1098527024 12:71498402-71498424 ATCTGCTGGTACCTTGATCTTGG - Intronic
1098671940 12:73241826-73241848 ATCTGTTGGTACCTTAATCTTGG - Intergenic
1098798111 12:74919442-74919464 GTCTGTCAGTGCCTTAATCTTGG + Intergenic
1099161425 12:79246513-79246535 ACCTGTTGGTACCTTGATCTTGG - Intronic
1099162235 12:79257032-79257054 ATCTTTAAGATCATTTATCTTGG - Intronic
1099218986 12:79889813-79889835 ATCTGCCAGTGCCTTGATCTTGG - Intronic
1099277968 12:80602482-80602504 ATCTGTCTGCACCTTCATCTTGG - Intronic
1099359494 12:81682322-81682344 ATCTGCAAACACCTTCATCTTGG + Intronic
1099441705 12:82707153-82707175 ATCTGCTAGCACCTTGATCTTGG - Intronic
1099748202 12:86734702-86734724 ATCTGTCAGAGCCTTGATCTTGG + Intronic
1099821163 12:87712213-87712235 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1100097956 12:91066814-91066836 ATCTGTCAGCACCTTTACTTTGG + Intergenic
1100218279 12:92476604-92476626 ATCTGTCAGTACATTGATCTTGG + Intergenic
1100223728 12:92535176-92535198 ATCTGCCAGTACCTTGATGTTGG - Intergenic
1100255246 12:92876554-92876576 ATCTGCCAGCACCTTGATCTTGG + Intronic
1100270162 12:93016944-93016966 ATCTGTCAATACCTTAATTTTGG + Intergenic
1100298043 12:93280974-93280996 ATCTGCCAGTACCTTGATCTTGG - Intergenic
1100372880 12:93984883-93984905 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1100610106 12:96184777-96184799 GTCTGTCAGCACCTTGATCTTGG + Intergenic
1100783674 12:98056258-98056280 ATCTACCAGCACCTTTATCTTGG + Intergenic
1101022386 12:100566348-100566370 ATCTGCCAGTGCCTTCATCTTGG - Intergenic
1101148539 12:101864246-101864268 ATCTGCAAGCACCTTGATCTTGG + Intergenic
1101363186 12:104047189-104047211 ATCTGCCAGCACCTTGATCTTGG - Intronic
1101669798 12:106858365-106858387 ATCTGTAAGTTACTTTGTGTGGG + Intronic
1101786848 12:107891720-107891742 ATCTGTCAGTGCCTTGATCTTGG + Intergenic
1102553466 12:113710083-113710105 ATCTGACAGCACCTTGATCTTGG + Intergenic
1102603582 12:114051821-114051843 ATCTGTCACTCCCTTGATCTTGG - Intergenic
1102713722 12:114951968-114951990 ATCTGGGGGTACCTTGATCTTGG + Intergenic
1104110005 12:125695938-125695960 ATCTGTCAGCACCTTAATCTTGG - Intergenic
1104128361 12:125869071-125869093 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1104558679 12:129824680-129824702 ATCTGCAGGCACCTTGATCTGGG + Intronic
1106384696 13:29272885-29272907 ATCTGTCAGCCCCTTGATCTTGG - Intronic
1106767053 13:32923595-32923617 ATCTGTATGGACGTTTTTCTTGG + Intergenic
1106868517 13:33993914-33993936 TTCTATATGTACCTTTATCAAGG - Intergenic
1108038438 13:46316431-46316453 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1108258991 13:48638280-48638302 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1109120537 13:58450222-58450244 ATCTGCTAGCACCTTAATCTTGG + Intergenic
1109123873 13:58492947-58492969 ATCTTTCAGCACCTTGATCTTGG - Intergenic
1110008376 13:70300172-70300194 ACCTGTCAGCACCTTGATCTTGG - Intergenic
1110016328 13:70410024-70410046 ATCTGTTGGCATCTTTATCTTGG - Intergenic
1110285068 13:73740317-73740339 ATCTTTAGGTACCCTGATCTTGG + Intronic
1110838833 13:80117481-80117503 ATCTGCCAGCACCTTCATCTTGG + Intergenic
1111276261 13:85951482-85951504 ATCTGCCAGTGCCTTAATCTTGG - Intergenic
1111361395 13:87182332-87182354 ATCTGCTGGTACCTTTATCTTGG + Intergenic
1111607350 13:90558233-90558255 ATCTCTCAGAACCTTGATCTTGG + Intergenic
1111721637 13:91953686-91953708 ATCTGTCAGCACATTGATCTTGG - Intronic
1112719773 13:102230220-102230242 ATCTGCCAGTGCTTTTATCTTGG + Intronic
1113085957 13:106569842-106569864 CTCTGCTGGTACCTTTATCTTGG - Intergenic
1113086016 13:106570283-106570305 ATCTGCCAGTGCCTTAATCTTGG + Intergenic
1113131819 13:107045386-107045408 ATCTGCCAGTGCCTTGATCTGGG + Intergenic
1114910659 14:27191387-27191409 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1114949895 14:27736946-27736968 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1114962543 14:27911588-27911610 ATCTGCCAGTGCCTTTATCTTGG + Intergenic
1115229155 14:31139458-31139480 ATCTGCTAGCACCTTGATCTTGG + Intronic
1116070280 14:40035240-40035262 ATCTGCTAGCACCTTGATCTTGG - Intergenic
1116091531 14:40313240-40313262 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1116228010 14:42178036-42178058 ATCTGTAGGCATCTTGATCTTGG - Intergenic
1116367850 14:44090824-44090846 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1116543774 14:46136070-46136092 ATCTGTCAGCACCTTGATCTTGG + Intergenic
1116627916 14:47290376-47290398 ATCTGCAGGTGCCTTAATCTTGG + Intronic
1116790133 14:49330695-49330717 ATCTGTCAGCAATTTTATCTTGG - Intergenic
1117051675 14:51866606-51866628 ATCTGCCAGTACCTTGATCTTGG - Intronic
1117118026 14:52536289-52536311 ATCTGCCAGTACTTTGATCTTGG + Intronic
1117743324 14:58841877-58841899 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1118147957 14:63161124-63161146 GTCTGCCAGCACCTTTATCTTGG - Intergenic
1119277483 14:73371818-73371840 ACCTGCCAGTACCTTGATCTTGG + Intronic
1119302312 14:73581262-73581284 ATCTGTGGGTGCCTTGATCTTGG - Intergenic
1119593607 14:75913387-75913409 CTCTGTAATTACCTCTATCATGG + Intronic
1119687793 14:76646557-76646579 ATCTGCTAGCACCTTGATCTTGG - Intergenic
1119863587 14:77954959-77954981 ATCTGTGAGTGCCTTTATCTTGG - Intergenic
1119925817 14:78492630-78492652 ATCTGTAAATAGCTTTATACTGG - Intronic
1119967040 14:78928232-78928254 ATCTGTAACTACCTTTGCCTGGG - Intronic
1120241466 14:81954448-81954470 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1120295135 14:82630718-82630740 TTCTGCCAGTACCTTGATCTTGG + Intergenic
1120703256 14:87721997-87722019 TTCTGCAAGTACCTTGATTTTGG - Intergenic
1121156580 14:91690792-91690814 ATCTGCCTGCACCTTTATCTTGG - Intronic
1121373307 14:93381122-93381144 ACTAGTTAGTACCTTTATCTTGG - Intronic
1121577682 14:95001683-95001705 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1121734278 14:96206882-96206904 ATCTGCCAGTGCCTTGATCTCGG - Intronic
1121881449 14:97503944-97503966 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1121979319 14:98440600-98440622 ATCTGCAAGTGACTTGATCTTGG + Intergenic
1122038916 14:98968320-98968342 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1122105718 14:99452982-99453004 ATCTGCAAGTTCATTTCTCTAGG + Intronic
1122424000 14:101595109-101595131 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1122833507 14:104417818-104417840 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1123672535 15:22673893-22673915 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1123963762 15:25435654-25435676 ATTTGTTGGTACCTTGATCTTGG + Intronic
1124324585 15:28747182-28747204 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1124412248 15:29446160-29446182 ATCTGCCAGCACCTTGATCTTGG + Intronic
1125119377 15:36135803-36135825 ACCTGCTAGTACCTTGATCTTGG - Intergenic
1125347582 15:38733641-38733663 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1126299237 15:47176741-47176763 ATCTGCCAGTACCTTGATCTTGG - Intergenic
1126910965 15:53416416-53416438 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1127399259 15:58569772-58569794 ATCTGCTGGCACCTTTATCTTGG + Exonic
1127536161 15:59891814-59891836 ATCTGTAAGTTAGCTTATCTTGG - Intergenic
1127733814 15:61823348-61823370 ATTTGTCAGTGCCTTGATCTTGG + Intergenic
1127799011 15:62461934-62461956 ATCTGTCTGTACTTTTAACTAGG + Intronic
1128320193 15:66688044-66688066 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1129133181 15:73519362-73519384 ATCTGCCAGCACCTTGATCTTGG + Intronic
1129666777 15:77583616-77583638 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1130121246 15:81049420-81049442 ATCTGTCAGTATCTTGATCTTGG + Intronic
1130163207 15:81423283-81423305 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1130318545 15:82818797-82818819 ATCTGCAGGCACCTTGATCTTGG - Intronic
1130323238 15:82857289-82857311 ATCTGCCAGTGCCTTAATCTTGG + Intronic
1130672916 15:85928815-85928837 ATCTGTAAGAACCTTTATACCGG - Intergenic
1130907726 15:88252082-88252104 TCCTGGAAGTACCTTTCTCTGGG + Intronic
1130971553 15:88737689-88737711 ATCTGTTAGCACCTTGATCTTGG + Intergenic
1131322195 15:91405240-91405262 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1131393423 15:92067849-92067871 ATCTGCAAGTGTCTTGATCTTGG - Intronic
1131876393 15:96811382-96811404 ACCTGCCAGTACCTTGATCTTGG + Intergenic
1132005180 15:98220023-98220045 ATTTATCAGTAGCTTTATCTGGG - Intergenic
1132075917 15:98819527-98819549 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1133094271 16:3430712-3430734 ATCTGCCAGCACCTTGATCTGGG - Intronic
1133830706 16:9320864-9320886 ATCTGTTGGTTCCTTGATCTTGG - Intergenic
1134078152 16:11306784-11306806 ATCTGCCAGCACCTTCATCTTGG + Intronic
1134186948 16:12091894-12091916 ATCTGTCGGTGCCTTGATCTTGG + Intronic
1134240858 16:12505316-12505338 ATATGCTAGCACCTTTATCTTGG - Intronic
1134296251 16:12948549-12948571 ATCTGCCAGCACCTTGATCTTGG - Intronic
1134342594 16:13358775-13358797 AGCTGTAATAACCTTTCTCTTGG + Intergenic
1134503962 16:14790583-14790605 ATCTGCAGGTGCCTTGATCTGGG + Intronic
1134576610 16:15338325-15338347 ATCTGCAGGTGCCTTGATCTGGG - Intergenic
1134725829 16:16418174-16418196 ATCTGCAGGTGCCTTGATCTGGG + Intergenic
1134941604 16:18293685-18293707 ATCTGCAGGTGCCTTGATCTGGG - Intergenic
1135059879 16:19262384-19262406 ATCTGCTGGTACCTTGATCTGGG + Intronic
1135119930 16:19756985-19757007 ATCTGCCAGCACTTTTATCTTGG + Intronic
1135279689 16:21143459-21143481 ATCTGTTGGTACCTTGATCTCGG + Intronic
1135345946 16:21688597-21688619 GTCTGTCAGCACCTTGATCTTGG - Intronic
1135854443 16:25993856-25993878 ATCTGCCAGCACCTTGATCTTGG - Intronic
1136583777 16:31170497-31170519 ATCTGCAAATACCCTTAACTGGG - Intergenic
1137382385 16:48011441-48011463 ATGTGTCAGAACCTTGATCTTGG - Intergenic
1137415892 16:48279063-48279085 ATCTATAAGTATCTTTCTCATGG - Intronic
1137691264 16:50429675-50429697 ATCTGCTGGTGCCTTTATCTTGG + Intergenic
1137909458 16:52361612-52361634 GTCTGTCAGCACCTTCATCTTGG + Intergenic
1138231146 16:55337332-55337354 ATCAGCTAGTACCTTGATCTGGG - Intergenic
1138241139 16:55428076-55428098 ATCTGCCAGTAACTTGATCTTGG - Intronic
1138692260 16:58779396-58779418 ATCTGCTAGCACCTTAATCTTGG - Intergenic
1138693202 16:58788101-58788123 ATCTGCTAGCACCTTAATCTTGG - Intergenic
1138854336 16:60670200-60670222 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1139462620 16:67134646-67134668 ATCTGCCAGTGCCTTGATCTTGG - Intronic
1139810433 16:69611572-69611594 ATCTGTTGGTGCCTTTATCCTGG - Intronic
1139939652 16:70596090-70596112 ATCTGTCAGCGCCTTGATCTTGG - Intronic
1140332743 16:74073427-74073449 ATCTGTAAGCACCTTGATATTGG + Intergenic
1141676420 16:85520122-85520144 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1142021873 16:87788547-87788569 ATCCATAAGTAAATTTATCTAGG + Intergenic
1142386210 16:89766406-89766428 ATCTTTAAATTCCTTTGTCTGGG + Intronic
1143743655 17:8973500-8973522 ATCTGCCAGTAACTTGATCTTGG + Intergenic
1143782328 17:9235606-9235628 ATCTGTTGGCACCTTGATCTTGG - Intronic
1143910620 17:10245832-10245854 ATCTGTCTGCACCTTGATCTTGG - Intergenic
1144118544 17:12126459-12126481 ATCTGTCAGTGCCTTGATCTTGG - Intronic
1144585547 17:16485476-16485498 ATCTGCCAGCACCTTCATCTTGG + Intronic
1147719534 17:42530365-42530387 ATCTATAAGCACCTTGATCTTGG - Intergenic
1148094825 17:45045072-45045094 ATCTATAGGCACCTTTATCTAGG + Intronic
1148094828 17:45045104-45045126 ATCTATAGGCACCTTTATCTAGG + Intronic
1149357238 17:55853019-55853041 ATCTGTTGGCACCTTCATCTTGG + Intergenic
1150560384 17:66289289-66289311 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1151307722 17:73274058-73274080 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1151442789 17:74143939-74143961 ATCTGCCAGTGCCTTGATCTGGG - Intergenic
1153139757 18:1956974-1956996 ATCTGTCAGTGCCTTAATCTTGG - Intergenic
1153408815 18:4770615-4770637 ATCTGCAGGTGCCTTTATCTTGG - Intergenic
1153509120 18:5833216-5833238 ATCTGTCAGCACTTTGATCTTGG + Intergenic
1153519839 18:5941242-5941264 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1153553642 18:6287135-6287157 ATTTGTAACTAAATTTATCTAGG - Intronic
1153646343 18:7199505-7199527 ATCTGTTAGCACCTTGCTCTCGG - Intergenic
1153890273 18:9507791-9507813 ATCTGTCAGCATCTTGATCTTGG - Intronic
1153923471 18:9811987-9812009 ATCTGCCAGCACCTTGATCTTGG - Intronic
1153967882 18:10198067-10198089 ATCTGTTTGAACCTTAATCTCGG - Intergenic
1154112383 18:11581183-11581205 ATCTGCAAGAGTCTTTATCTGGG - Intergenic
1154929679 18:20979969-20979991 TTCTTTAAGTTCCTTTACCTGGG + Exonic
1154957535 18:21274101-21274123 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1155424652 18:25694429-25694451 TTATGCAAGTACCTTAATCTGGG + Intergenic
1155451697 18:25970113-25970135 ATCTGTGGGTGCCTTGATCTTGG + Intergenic
1155605978 18:27606395-27606417 ATCTGTCAGCACCTTGATCTTGG - Intergenic
1155650933 18:28140617-28140639 ATCTGCAAGCACTTTGATCTTGG + Intronic
1155724377 18:29061058-29061080 ATCCGTAAGTGCCTTGATCTTGG + Intergenic
1155767112 18:29649703-29649725 ATCTGTAGGCACCGTGATCTTGG - Intergenic
1156110457 18:33719819-33719841 ATCTGCTGGTACCTTAATCTTGG + Intronic
1156575598 18:38311916-38311938 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1156656465 18:39294370-39294392 ATCTGTAATTACCTTTTGCCTGG - Intergenic
1156708310 18:39911100-39911122 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1156734427 18:40236237-40236259 ATCTGACAGTACCTCAATCTTGG - Intergenic
1156882799 18:42100933-42100955 ATCTGCCAGTGCCTTCATCTTGG - Intergenic
1157049283 18:44141996-44142018 ATCTGCCAGTGTCTTTATCTTGG + Intergenic
1157383008 18:47236693-47236715 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1157397790 18:47357144-47357166 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1157416346 18:47506510-47506532 ATCTGACAGTGCCTTAATCTTGG + Intergenic
1157783712 18:50463463-50463485 ATCTGTTAGCACCTTGATCTTGG - Intergenic
1157909233 18:51599528-51599550 TTCTGAAATTACCTTTTTCTAGG + Intergenic
1158120818 18:54046620-54046642 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1158847168 18:61456791-61456813 ATCTGCCAGCACCTTGATCTTGG - Intronic
1158887270 18:61840205-61840227 ATCTGCCAGCACCTTGATCTTGG + Intronic
1158943622 18:62429092-62429114 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1158999236 18:62956238-62956260 ATCTGCTGGTACCTTCATCTTGG - Intronic
1159443550 18:68511566-68511588 ATCTGTAGGTGCCTTGATCTTGG + Intergenic
1159560109 18:69984513-69984535 ATCTGCCAGTTCCTTCATCTTGG - Intergenic
1159791092 18:72779868-72779890 ATCTGCCAGCACCTTGATCTCGG - Intronic
1159807914 18:72978193-72978215 ATCTGTTGGCACCTTTATCGTGG - Intergenic
1159854282 18:73565659-73565681 ATCTGCCAGTACCTTATTCTTGG + Intergenic
1159929941 18:74300138-74300160 ATTTGTAACTAAATTTATCTAGG - Intergenic
1161750126 19:6089677-6089699 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1162978572 19:14223472-14223494 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1163398434 19:17077228-17077250 AACTGTAGGGATCTTTATCTGGG + Intronic
1164610249 19:29626871-29626893 ATCTGCCAGAACCTTGATCTTGG - Intergenic
1164764303 19:30752062-30752084 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1164861778 19:31567371-31567393 ATCTGTAAGAACCTTGGTGTTGG + Intergenic
1164962261 19:32443562-32443584 ATCTGCCAGTTCCTTGATCTTGG + Intronic
1165728314 19:38127936-38127958 ACCTGCGGGTACCTTTATCTTGG - Intronic
1166126651 19:40718772-40718794 ATTTGTATGTACATTTTTCTAGG + Intronic
1167809119 19:51813202-51813224 ATCTGCTAGCACCTTGATCTTGG - Intronic
925498055 2:4474139-4474161 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
925594933 2:5545545-5545567 ATCTGTGAGCACCTTGATCTTGG + Intergenic
925618392 2:5766269-5766291 AACTGTAAGTTCATTTTTCTTGG - Intergenic
925643157 2:6006668-6006690 ATCTGCCAGCACCTTGATCTTGG + Intergenic
925677074 2:6374017-6374039 ATCTGCCAGTAGCTTAATCTAGG + Intergenic
926527971 2:14006634-14006656 ATCTGTCAGTGGCTTGATCTTGG + Intergenic
926732476 2:16046881-16046903 GTCTGTTGGTACCTTGATCTTGG + Intergenic
926840371 2:17073141-17073163 ATCTGCTGGTACCTTGATCTTGG + Intergenic
927236745 2:20881768-20881790 ATCTGCCAGCACCTTGATCTTGG + Intergenic
927466121 2:23337915-23337937 AACTGATAGTACCTTGATCTCGG + Intergenic
928185438 2:29105844-29105866 ATCTGCCAGTGCCTTGATCTTGG + Intronic
928245900 2:29626719-29626741 ATCTGCCAGCACCTTGATCTTGG + Intronic
928389504 2:30898213-30898235 ATGTGTAGGGACCTTAATCTTGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
928936438 2:36683849-36683871 ATCTGCAGGCACCTTGATCTTGG - Intergenic
929166618 2:38888148-38888170 ATCTGCTAGTGCCTTGATCTTGG + Intronic
929356766 2:41034418-41034440 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
929390787 2:41466270-41466292 ATCTTCCAGTACCTTGATCTTGG - Intergenic
929448086 2:42015901-42015923 ATCTGTTGGCACCTTGATCTTGG - Intergenic
929783856 2:44975197-44975219 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
930100459 2:47599169-47599191 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
930867482 2:56136165-56136187 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
930897449 2:56462562-56462584 ATCTGCCAGCACCTTGATCTTGG - Intergenic
930998583 2:57753434-57753456 CTCTGTAAGCACCTCTTTCTGGG - Intergenic
931221092 2:60288625-60288647 ATCTGCTAGCACCTTTATCTTGG + Intergenic
931381298 2:61756005-61756027 ATCTTTCAGCACCTTGATCTTGG - Intergenic
931967912 2:67553915-67553937 ATCTGAGAGAACCTTGATCTTGG - Intergenic
932071221 2:68622380-68622402 ATATGCCAGCACCTTTATCTTGG + Intronic
932291471 2:70583690-70583712 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
932515831 2:72348080-72348102 ATCTGTAGGTGCCTTGATCTTGG - Intronic
932784727 2:74590196-74590218 ATCTGCCAGCACCTTGATCTTGG - Intronic
932857797 2:75255716-75255738 ATCTGCCAGCACCTTGATCTTGG + Intergenic
932866419 2:75347683-75347705 ATCTGTTAGTTTCTTGATCTTGG + Intergenic
933546228 2:83716149-83716171 ATCTGTAGGTGCCTTGATGTTGG - Intergenic
933562007 2:83899403-83899425 ATCTGCTGGTACCTTAATCTTGG + Intergenic
935465845 2:103397182-103397204 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
935645817 2:105333390-105333412 ATCTGCCAGCACCTTGATCTTGG + Intergenic
936053884 2:109246266-109246288 ATCTGCCAGTGCCTTGATCTTGG - Intronic
937029734 2:118728464-118728486 ATCTGCTGGTACCTTGATCTTGG + Intergenic
937139159 2:119583896-119583918 ATCTGCCAGCACCTTGATCTTGG + Intronic
937161188 2:119763078-119763100 ATATGAAAGTACCATTGTCTAGG + Intronic
937423770 2:121780166-121780188 ATCAGTCAGAACCTTGATCTTGG - Intergenic
937433892 2:121864222-121864244 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
937440986 2:121915918-121915940 ATCTGTTGGTACCTTGATCTTGG - Intergenic
937506284 2:122540990-122541012 ATCTGCCAGTGCCTTGATCTGGG + Intergenic
937794501 2:126000800-126000822 ATGTGAAAGTGCCTTTGTCTGGG + Intergenic
938079384 2:128361530-128361552 ATCTGCCAGCACCTTGATCTTGG + Intergenic
938111131 2:128565810-128565832 ATCTGTAAATTCATTTAACTGGG - Intergenic
938132628 2:128730877-128730899 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
938208741 2:129446518-129446540 ATCTGTTGGCACCTTGATCTTGG - Intergenic
938556844 2:132432197-132432219 ATCTGCTAATACCTTGATCTTGG - Intronic
938928694 2:136067099-136067121 ATCTGCCAGCACCTTGATCTTGG + Intergenic
939252549 2:139700803-139700825 ATCTGCAAGTGCCTTGATCTTGG - Intergenic
939367075 2:141247376-141247398 ATTTCTAAGCAGCTTTATCTTGG + Intronic
939383763 2:141469455-141469477 ATCTGCTGGTACCTTGATCTTGG - Intronic
939392956 2:141592314-141592336 ATCTGTTGGTATCTTGATCTTGG - Intronic
939489951 2:142865454-142865476 ATCTGCCAGCACCTTGATCTTGG - Intergenic
939795016 2:146632579-146632601 ATCTGCCAGTACCTTCGTCTTGG - Intergenic
939949795 2:148456231-148456253 ATCTGCCAGTGCCTTTATCTTGG - Intronic
940093097 2:149944046-149944068 ATCTGCTAGTTCCTTAATCTTGG + Intergenic
940182207 2:150947281-150947303 ATCTGCCAGCACCTTGATCTTGG - Intergenic
940196865 2:151104484-151104506 ATCTGCCAGCACCTTGATCTTGG + Intergenic
940258338 2:151755898-151755920 ATCTGCCAGCACCTTGATCTTGG + Intergenic
940291453 2:152081349-152081371 CTCTGTCAGTATCTTGATCTTGG - Intronic
940459526 2:153946523-153946545 ATCTGCTAGCACCTTCATCTTGG - Intronic
940722097 2:157293249-157293271 ATCTGCTAGTGCCTTGATCTTGG - Intronic
940740401 2:157501273-157501295 ATCTTCTAGTACCTTAATCTTGG + Intergenic
940980691 2:159999151-159999173 ATCTGCTAGCACCTTAATCTTGG + Intronic
941313318 2:163961518-163961540 ATCTGTCAGTGCTTTGATCTTGG - Intergenic
941370118 2:164654619-164654641 ATCTGCCAGTGCCTTTATCTTGG + Intronic
941436880 2:165483677-165483699 ATCTATCAGCACCTTGATCTTGG - Intronic
941437013 2:165485111-165485133 ATCTATCAGCACCTTGATCTTGG - Intronic
941531729 2:166678797-166678819 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
942287375 2:174433754-174433776 ATCTGTTAGTGCCTTAATCTTGG + Exonic
942402596 2:175619275-175619297 AACAGGAAGTATCTTTATCTTGG - Intergenic
942620849 2:177844216-177844238 ATCTGCCAGTGCCTTGATCTTGG - Intronic
942650188 2:178158313-178158335 ATCTGCCAGCACTTTTATCTTGG - Intergenic
943281691 2:185942962-185942984 ACCTGTCAGCACCTTTGTCTCGG - Intergenic
943325161 2:186488710-186488732 ATCTGTAGGGACCTTAACCTTGG + Intronic
943595469 2:189850085-189850107 ATCTTTAACTACTTTTATGTGGG + Intronic
943990889 2:194690746-194690768 ATCTGTAAATACATTAATTTTGG + Intergenic
944167100 2:196734613-196734635 ATTTGCAAGCACCTTGATCTTGG + Intronic
944312304 2:198247139-198247161 ATCTATCAGTACCTTGATCTTGG + Intronic
944384346 2:199147957-199147979 ATCTGTTGGCACCTTAATCTTGG + Intergenic
944443651 2:199767768-199767790 ATCTGTCAGAACCTTAATCTTGG + Intronic
944623793 2:201548244-201548266 ATCTGCCAGCACCTTGATCTTGG - Intronic
944701712 2:202251740-202251762 ATCTGTCAACACCTTGATCTTGG - Intergenic
945048060 2:205799190-205799212 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
945061643 2:205914337-205914359 ATCATTTATTACCTTTATCTTGG + Intergenic
945282309 2:208047444-208047466 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
945524748 2:210874389-210874411 ATCTGATGGTACCTTGATCTTGG - Intergenic
946015515 2:216601001-216601023 ATCTGCCAGCACCTTGATCTTGG + Intergenic
946563477 2:220939084-220939106 ATCTATAAGCACCTTGATCTTGG - Intergenic
946579219 2:221108217-221108239 ATATGTAAGTAACTTGATATAGG + Intergenic
946918634 2:224553784-224553806 ACCTGCAAGCACCTTGATCTTGG + Intronic
946996284 2:225395601-225395623 ATCTGCCAGCACCTTGATCTTGG + Intergenic
947121811 2:226823238-226823260 ATCTGTCAGTCTCTTGATCTTGG + Intergenic
947258164 2:228189470-228189492 ATCTGCCAGCACCTTGATCTTGG - Intergenic
947294991 2:228621113-228621135 CTCTGTTAGTACCTTTAGCAGGG + Intergenic
947673589 2:231958583-231958605 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
947985166 2:234441374-234441396 ATCAGCCAGTACCTTGATCTAGG - Intergenic
948027079 2:234786842-234786864 ATCTGCCAGCACCTTGATCTTGG - Intergenic
948146723 2:235713803-235713825 ATCTGCAGGTGCCTTGATCTTGG - Intronic
948326247 2:237124063-237124085 ATCTGCCAGCACCTTGATCTTGG + Intergenic
948449408 2:238060186-238060208 AGATGTTAGTGCCTTTATCTGGG - Intronic
948512480 2:238478021-238478043 ATCTGCTAGTACCTTGATCTCGG + Intergenic
1168865371 20:1081439-1081461 ATCTGCCAGTGCCTTAATCTTGG + Intergenic
1169315862 20:4590609-4590631 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1169451657 20:5717156-5717178 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1169465493 20:5834792-5834814 ATCTGTTAGCACCTTGATCTTGG - Intronic
1169701943 20:8456738-8456760 ATCTGCCAGCACCTTGATCTTGG - Intronic
1169844168 20:9971685-9971707 ATCTGTTGATACCTTGATCTCGG + Intergenic
1169872331 20:10261305-10261327 GTGTGTAGGTACCTTTATCCTGG - Intronic
1169990227 20:11494593-11494615 ATCTGACAGTACCTTAATCTTGG + Intergenic
1170391948 20:15884829-15884851 ATCTGCCAGCACCTTGATCTTGG - Intronic
1170451788 20:16490695-16490717 ATCTGCCAGCACCTTGATCTTGG + Intronic
1170676336 20:18484572-18484594 ATCTGTAAGCACCTTGATCTTGG + Exonic
1171061591 20:21968749-21968771 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1173020503 20:39263953-39263975 ATCTGCCAGTTCCTTGATCTTGG - Intergenic
1173044110 20:39493007-39493029 ATCTGCAAGTGCCTTGATCTGGG + Intergenic
1173060932 20:39660482-39660504 ATCAGCAAGAACCTTGATCTTGG - Intergenic
1173258229 20:41410369-41410391 ATCTGTCAGTGCCTTGACCTTGG + Intronic
1173574598 20:44104016-44104038 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
1173678654 20:44860485-44860507 ATCTGCAAGCATCTTGATCTTGG - Intergenic
1174650431 20:52120177-52120199 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1174700720 20:52605634-52605656 ATCTGTCTGAACCTTGATCTGGG + Intergenic
1174777546 20:53359087-53359109 ATCTGTAAGTACTATTTTTTTGG + Intronic
1174972707 20:55294715-55294737 TTTTGTAAGTGACTTTATCTTGG + Intergenic
1175039435 20:56033065-56033087 ATCTGATAGCACCTTAATCTTGG - Intergenic
1175733246 20:61368457-61368479 ATCTGCAGGCACCTTGATCTTGG + Intronic
1176691157 21:9911368-9911390 ATTTGTCAGTTCATTTATCTAGG - Intergenic
1176884690 21:14241516-14241538 ATCTATCAGCACCTTGATCTTGG + Intergenic
1176935137 21:14859237-14859259 ATCTGTCAGTGCCTTGATCTTGG - Intergenic
1177111308 21:17032859-17032881 ATCAGCCAGTACCTTGATCTTGG - Intergenic
1177203612 21:17985871-17985893 ATCTGCTGGTACCTTGATCTTGG - Intronic
1177220461 21:18185754-18185776 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1177245867 21:18522406-18522428 ATCTCTCAGTACCTTTTTCAAGG + Intergenic
1177302822 21:19272069-19272091 ATCTGTTAGCACTTTGATCTTGG - Intergenic
1177322063 21:19535665-19535687 TTCTGTTAGTGCCTTGATCTTGG + Intergenic
1177665551 21:24152711-24152733 ATCTGTTGGCACCTTGATCTTGG + Intergenic
1177842976 21:26255330-26255352 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1177918936 21:27125915-27125937 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1178082060 21:29076289-29076311 ATCTGCTAGCACCTTGATCTCGG + Intergenic
1178093727 21:29191705-29191727 ATCTGTGAGTACCTATCTATAGG - Intergenic
1178158122 21:29878791-29878813 ATCTGCCAGCACCTTGATCTTGG + Intronic
1178247683 21:30969587-30969609 ATCTGTCAGCACCTTGATCTTGG + Intergenic
1178305148 21:31485015-31485037 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1178374068 21:32051879-32051901 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1178495540 21:33082871-33082893 ACCTGTAACTACCTATATCAGGG - Intergenic
1178773466 21:35527300-35527322 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1178969744 21:37162821-37162843 ATCTGCCAGTACCTTGATCTTGG - Intronic
1179328492 21:40374836-40374858 ATCTGCCAATACCTTGATCTTGG + Intronic
1181077116 22:20387479-20387501 ATCTCCATGTACCTTTATATAGG - Intronic
1181420771 22:22796727-22796749 ACCTATAAACACCTTTATCTTGG - Intronic
1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG + Intronic
1181643329 22:24216360-24216382 ATCTGCCAGTACCTTGATCTTGG + Intergenic
1182450360 22:30416400-30416422 ATCTGTAAGTATCTCTGCCTTGG + Exonic
1182707285 22:32292538-32292560 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1182951131 22:34376960-34376982 ATCTGTCAGCACCTTGACCTTGG - Intergenic
1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG + Intronic
1183513494 22:38249654-38249676 ATCTGCCAGCACCTTGATCTTGG + Intronic
1183611912 22:38914389-38914411 ATCTGTTAGAGTCTTTATCTTGG + Intergenic
1183729909 22:39612482-39612504 ATCTGCCAGCACCTTGATCTTGG - Intronic
1183870868 22:40741189-40741211 ATCTGTCGGCACCTTGATCTTGG + Intergenic
1184014769 22:41777742-41777764 ATCTTTCAGTACCTTGATTTTGG - Intronic
1184290202 22:43494829-43494851 ATCTGCCAGCACCTTGATCTTGG - Intronic
1184395629 22:44235923-44235945 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1184622568 22:45693384-45693406 ATCTGCTGGTACCTTAATCTTGG - Intronic
1184722795 22:46325080-46325102 ATCTGCAGGTGCCTTGATCTTGG - Intronic
949266949 3:2168894-2168916 ATCTTTAATTTGCTTTATCTTGG - Intronic
949316016 3:2756434-2756456 ATCTGCTAGCACCTTGATCTTGG + Intronic
949373024 3:3355423-3355445 ATCTGCTGGTACCTTGATCTTGG + Intergenic
949591172 3:5495900-5495922 ATCTGCCAGCACCTTGATCTTGG + Intergenic
949596697 3:5555175-5555197 ATCTGTAGGCTCCTTAATCTTGG + Intergenic
949768836 3:7556083-7556105 ATCTGCCAGCACCTTGATCTTGG - Intronic
949843712 3:8349748-8349770 ATCTGATAGTGCCTTGATCTTGG + Intergenic
949873103 3:8606177-8606199 ATCTGCCAGCACCTTGATCTCGG - Intergenic
949908211 3:8877244-8877266 ATCTGCCAGTGCCTTGATCTTGG - Exonic
951326740 3:21312118-21312140 ATCAGCAAATACCTTCATCTTGG - Intergenic
951347473 3:21563272-21563294 ATTTGTCAGCACCTTGATCTTGG + Intronic
951478618 3:23135435-23135457 ACCTGTCAGTGCCTTGATCTTGG - Intergenic
951533953 3:23724857-23724879 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
951628132 3:24689385-24689407 ATCTGCCAGCACCTTGATCTTGG - Intergenic
951681099 3:25295432-25295454 ATCTGCTGGTACCTTGATCTTGG + Intronic
951760354 3:26140745-26140767 ATCTATTAGTCCCTTAATCTTGG + Intergenic
951835650 3:26980564-26980586 ATCTGTCAGCACCCTGATCTTGG - Intergenic
952068806 3:29607337-29607359 ATCTGTCAGCACCTTGATCTTGG - Intronic
952140969 3:30478992-30479014 ATCTGTCAGCATCTTGATCTTGG - Intergenic
952356452 3:32589426-32589448 ATCTGTAACTTCCTTTCTCAAGG + Intergenic
952748274 3:36802595-36802617 ATCTGCTAGCACCTTGATCTTGG + Intergenic
952775112 3:37038334-37038356 ATCTGTCGGTGCCTTGATCTTGG - Intronic
952814833 3:37438254-37438276 ATCTGTCAGCACCTTGATCTTGG - Intergenic
952939275 3:38429509-38429531 ATCTGTGAACACCTTGATCTTGG - Intergenic
953548080 3:43878928-43878950 ATCTGCCAGCACCTTGATCTTGG + Intergenic
953755085 3:45639477-45639499 ATCTGCCAGCACCTTGATCTTGG - Intronic
953812241 3:46123277-46123299 ATCTGTATGTAGCTTGATCTTGG + Intergenic
954898251 3:53995984-53996006 ATCTGCTGGTACCTTGATCTTGG + Intergenic
955050579 3:55406677-55406699 ATCTGCCAGTATCTTGATCTTGG + Intergenic
955289752 3:57680524-57680546 ATCAGCCAGTACCTTGATCTTGG + Intronic
955569499 3:60289325-60289347 TTCTGTAAATCCATTTATCTAGG - Intronic
955847488 3:63181402-63181424 ATCTGCCAGTGCCTTAATCTTGG - Intergenic
956041569 3:65150466-65150488 ATCTGCAAGTGTCTTGATCTTGG + Intergenic
956126737 3:66017978-66018000 ATCTGTAAATTGCTTTGTCTTGG + Intronic
956174549 3:66460623-66460645 ACCTGCCAGTACCTTGATCTTGG + Intronic
956524061 3:70138355-70138377 ATCTGCCAGTCCCTTGATCTTGG - Intergenic
956689544 3:71863353-71863375 ATCTTTCAGTGCCTTGATCTTGG - Intergenic
956757374 3:72402119-72402141 ATCTGCCAGCACCTTGATCTTGG + Intronic
956891164 3:73615647-73615669 ATCTGCTAGCACCTTGATCTAGG + Intronic
956940318 3:74153133-74153155 ATCTGCAAGCTCCTTGATCTTGG - Intergenic
957012689 3:75026574-75026596 ATCTGCAGGCACCTTGATCTTGG + Intergenic
957184502 3:76924454-76924476 ATCTGCCAGTGCCTTGATCTTGG + Intronic
957313800 3:78551804-78551826 ACCTGTAGGCACCTTGATCTTGG + Intergenic
957459733 3:80501155-80501177 ATCTGCCAGCACCTTGATCTTGG - Intergenic
957561916 3:81832897-81832919 ATCTGCCAGTGCCTTTATCTTGG + Intergenic
957648962 3:82974469-82974491 ATCTGTCTGTACCTTGATCCTGG + Intergenic
957778266 3:84784737-84784759 ATTTGCCAGTACCTTAATCTTGG - Intergenic
957937579 3:86964724-86964746 ATCTTTTAGAACCTTGATCTTGG + Intronic
958567122 3:95828565-95828587 ATTTGTAAGTGCCTGGATCTTGG + Intergenic
958582071 3:96039713-96039735 ATCTTTCAGTTTCTTTATCTTGG - Intergenic
958614623 3:96476069-96476091 ATCTGTTGGTACCTTACTCTTGG - Intergenic
958640310 3:96796963-96796985 TTCTGTAAGTAACTATATCTTGG - Intergenic
958711050 3:97717448-97717470 AGCTGTCAGCACCTTGATCTTGG - Intronic
959014729 3:101121047-101121069 ACCAGTCAGTACCTTGATCTTGG - Intergenic
959072674 3:101717417-101717439 ATCAGTAAGTACCTTTTGCCGGG + Intergenic
959332343 3:105022077-105022099 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
959390407 3:105765449-105765471 ATTTGTCAGCACCTTGATCTTGG + Intronic
959407261 3:105975606-105975628 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
959508963 3:107188578-107188600 ATCTGCCAGCACCTTGATCTTGG - Intergenic
960066824 3:113383280-113383302 ATCTGCCAGTCCCTTGATCTTGG - Intronic
960078833 3:113518832-113518854 ATTTGTTAGTGCCTTGATCTTGG + Intergenic
960121253 3:113950361-113950383 ATCTGCCAGTGCCTTGATCTTGG - Intronic
960280441 3:115775342-115775364 ATCTGTTAGCACTTTGATCTAGG + Intergenic
960447663 3:117767217-117767239 ATCTGCAAGTACCTTGATCTTGG + Intergenic
960461813 3:117944634-117944656 ATCTGCCAGTTCCTTGATCTTGG + Intergenic
960487779 3:118274208-118274230 ATCTGCCAGCACCTTGATCTTGG - Intergenic
960843241 3:121981572-121981594 ATCTGCAGGCACCTTAATCTTGG + Intergenic
960895331 3:122498409-122498431 ATCTGCCAGTGCCTTGATCTTGG + Intronic
961121394 3:124374215-124374237 ATCTGTGGGTACCTTGATCTTGG + Intronic
961251811 3:125513290-125513312 ATCTGCCAGTTCCTTAATCTTGG + Intronic
961567306 3:127772931-127772953 ATCTGTCAGCACCTTGACCTTGG + Intronic
961853792 3:129849160-129849182 ATTTGTAAGTATCTCTATATCGG + Intronic
962607609 3:137045497-137045519 ATCTGCCAGCACCTTGATCTTGG - Intergenic
962685461 3:137843288-137843310 ATCTGCTGGTACCTTGATCTTGG + Intergenic
962940783 3:140123077-140123099 ATCTGCCAGCACCTTCATCTTGG - Intronic
963006755 3:140733625-140733647 ATCTGCAGGCACCTTGATCTTGG - Intergenic
963713186 3:148771113-148771135 ATCTGCCAGCACCTTGATCTTGG + Intergenic
963850906 3:150209484-150209506 ATCTGCTGGTACCTTGATCTTGG + Intergenic
964265506 3:154890311-154890333 ATCTGGAGGTGCCTTGATCTTGG + Intergenic
964399896 3:156288068-156288090 TGCTGCAAGTACCTTGATCTTGG - Intronic
964626188 3:158762296-158762318 ATCTGCCAGTGCCTTGATCTTGG + Intronic
964828860 3:160860739-160860761 ATCTGCCAGCACCTTGATCTTGG - Intronic
964912197 3:161797030-161797052 ATATGTAAGTAGCTTGATGTAGG - Intergenic
965441382 3:168719364-168719386 ATCAGCCAGTACCTTGATCTTGG + Intergenic
965733871 3:171800747-171800769 ATCTGCAAGCACCTTGATCTTGG - Intronic
965950788 3:174305624-174305646 ATCTGTCAGTGCCTTGATCTTGG - Intergenic
966083936 3:176043569-176043591 ATCTGACAGCACCTTGATCTTGG - Intergenic
966144794 3:176798538-176798560 ATCTGTGCATACCTTGATCTTGG - Intergenic
966398979 3:179528650-179528672 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
966558098 3:181286282-181286304 ATCTGCCAGCACCTTGATCTTGG + Intergenic
966693817 3:182768839-182768861 ATCTGCTAGCACCTTGATCTTGG - Intergenic
966950147 3:184809735-184809757 AACTATAAGTGCCTTTTTCTGGG + Intergenic
966959329 3:184917904-184917926 ATCTGCCAGCACCTTGATCTTGG - Intronic
967719617 3:192801680-192801702 ATCTGCAGGCACCTTGATCTTGG + Intronic
967772836 3:193353745-193353767 ATATGCAAGCACCTTGATCTTGG + Intronic
967774903 3:193376256-193376278 ATCTGCCAGCACCTTGATCTTGG - Intronic
967924618 3:194636327-194636349 ATCTGCAGGCACCTTGATCTCGG + Intergenic
967992395 3:195141080-195141102 ATCTGCCAGCACCTTGATCTTGG + Intronic
968942739 4:3647225-3647247 ATCTGCAGGCACCTTAATCTTGG + Intergenic
969103434 4:4787086-4787108 ATCTGCTAGTACCCTGATCTTGG + Intergenic
969177253 4:5408041-5408063 ATCTGTCAGGGCCTTGATCTTGG + Intronic
969197211 4:5572568-5572590 ATCTGCAGGTACCTTGATTTCGG + Intronic
969283484 4:6187644-6187666 ATCTGCCGGTACCTTGATCTTGG + Intronic
970067013 4:12107121-12107143 ACCTGTGAATACCTTGATCTTGG - Intergenic
970186502 4:13460243-13460265 ATCCGTCAGTACCTTGATCTTGG - Intronic
970340082 4:15097010-15097032 ATCTGTGAGCATCTTGATCTTGG + Intergenic
970642313 4:18080740-18080762 ATCTGCTAGCACCTTGATCTTGG - Intergenic
970698297 4:18704386-18704408 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
970770602 4:19607697-19607719 ATCTGCTAGCACCTTCATCTTGG - Intergenic
970797976 4:19937540-19937562 ATCAGTCAGTACCTTTATTGGGG - Intergenic
970905592 4:21212614-21212636 ATCTGCCAGTGCCTTCATCTTGG - Intronic
970988884 4:22190495-22190517 ATCTGCCAGCACCTTGATCTTGG - Intergenic
971022617 4:22552935-22552957 ATCTGACAGTACCTTGATCTTGG - Intergenic
971090326 4:23335715-23335737 ACCTGTTGGTACCTTGATCTTGG + Intergenic
971232767 4:24813247-24813269 ATCTCTTAGCACCTTGATCTTGG + Intronic
971409620 4:26356228-26356250 AGCTGTGAGTACTTTTAGCTAGG + Intronic
971459693 4:26881567-26881589 ATCTGCTGGTGCCTTTATCTTGG + Intronic
971460663 4:26892298-26892320 ATCTGCCAGCACCTTGATCTTGG - Intronic
971487622 4:27176290-27176312 ATCTGCCAGTACCTTGGTCTTGG - Intergenic
971490176 4:27203739-27203761 ATCTGTCAAAACCTTGATCTTGG + Intergenic
971903878 4:32700133-32700155 ATCTGCCAGCACCTTGATCTTGG + Intergenic
972279333 4:37587291-37587313 ATCTGCAAATACCTTTAATTTGG + Intronic
972709887 4:41584896-41584918 ATCTGCCAGTGCCTTGATCTTGG - Intronic
972862067 4:43181444-43181466 ATCTGCCAGCACCTTGATCTTGG - Intergenic
972914699 4:43861111-43861133 ATCTGCCAGTACCTTGATCTTGG + Intergenic
973073587 4:45895839-45895861 ATCTGCTAGCACCTTGATCTTGG - Intergenic
973075418 4:45918867-45918889 ATCTGCCAGCACCTTGATCTTGG - Intergenic
973163251 4:47045578-47045600 ATCTGTCAGTGCCTTGATCTTGG - Intronic
973741702 4:53925128-53925150 ATCTCTAAGTAACTTTAGTTAGG - Intronic
973834685 4:54797381-54797403 ATCTGTCTGTACCCTGATCTTGG + Intergenic
973971046 4:56214137-56214159 ATCTGACAGTGCCTTGATCTTGG - Intronic
974484917 4:62492699-62492721 ATCTGGTGGTTCCTTTATCTTGG + Intergenic
974511120 4:62842111-62842133 ATCTGAAAGTACCTTGATAATGG + Intergenic
974750517 4:66134586-66134608 ATCTGCTGGTGCCTTTATCTTGG - Intergenic
974811689 4:66954025-66954047 ATCTGTCAGCAGCTTGATCTTGG + Intergenic
975312488 4:72918178-72918200 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
975320379 4:73003702-73003724 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
975364202 4:73509693-73509715 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
975531820 4:75407386-75407408 ATCTGTTGGCACCTTGATCTTGG - Intergenic
975656838 4:76649945-76649967 TTCTGCAAGCACCTTGATCTTGG - Intronic
975974900 4:80083936-80083958 ATCTGTTGGTACCTTGATCTTGG - Intronic
976188623 4:82467991-82468013 ATCTGCCAGAACCTTGATCTTGG + Intergenic
976334687 4:83871746-83871768 ATCTGCCAGCACCTTGATCTTGG - Intergenic
976376287 4:84349425-84349447 ATCTGCTGGTACCTTGATCTTGG - Intergenic
976551018 4:86395708-86395730 ATCTGCCAGCACCTTGATCTTGG - Intronic
976563736 4:86530568-86530590 ATCTGCCAGTGCCTTGATCTTGG - Intronic
976614461 4:87062230-87062252 ATCTGTTAGCACCTTGATCTTGG - Intronic
976736655 4:88317071-88317093 ATCTGCCAGTACCTTGATCTTGG + Intergenic
976988294 4:91329562-91329584 ATCTGCTAGCACCTTGATCTTGG - Intronic
977335932 4:95699513-95699535 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
977557096 4:98497432-98497454 ATCTGTCACCACCTTGATCTTGG + Intronic
977605332 4:98978905-98978927 ATCTGTTGGCACCTTGATCTTGG - Intergenic
977877939 4:102170665-102170687 ATCTGTGAGTGAATTTATCTAGG - Intergenic
977893176 4:102335484-102335506 ATCTGTATGGACCTCTATATGGG - Intronic
977954393 4:103010590-103010612 ATCTGTCAGCACTTTGATCTTGG - Intronic
978430778 4:108630971-108630993 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
978531327 4:109717108-109717130 ATCTGCTAGTGCCTTGATCTTGG + Intronic
978937084 4:114390665-114390687 ATCTATAAATACATTTAACTGGG - Intergenic
979006388 4:115303213-115303235 ATCTGCCAGTATCTTGATCTTGG + Intergenic
979080154 4:116328824-116328846 ATCTGCCAGCACCTTGATCTTGG - Intergenic
979151478 4:117321466-117321488 ATCTGCAAATACCTTGATCTTGG + Intergenic
979174382 4:117644417-117644439 ATCTGTTAGCATCTTAATCTTGG - Intergenic
979618152 4:122768099-122768121 ATCTGTTGGTACCTTGATCTTGG - Intergenic
979631978 4:122913227-122913249 ATCTGCCAGCACCTTGATCTTGG - Intronic
979731213 4:124024653-124024675 ATCTGTTGGCACCTTGATCTTGG + Intergenic
979797202 4:124861164-124861186 ATCTGCAAGCACCTTGACCTTGG - Intergenic
979901213 4:126220935-126220957 ATCTGTAGGTGCCTTGGTCTTGG - Intergenic
979925575 4:126558878-126558900 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
980732035 4:136835988-136836010 ATCAGCCAGTACCTTAATCTTGG + Intergenic
980842318 4:138278732-138278754 ATCTGCCAGCACCTTGATCTTGG + Intergenic
980979941 4:139646106-139646128 ATCTGCCAGCACCTTGATCTGGG + Intergenic
981102670 4:140847375-140847397 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
981135135 4:141202059-141202081 ATCTGATAGTACCTTGAGCTTGG + Intronic
981201059 4:141979928-141979950 ATCTTAAATTTCCTTTATCTGGG + Intergenic
981535058 4:145791176-145791198 ATCTGCCAGTGCCTTGATCTTGG - Intronic
981676779 4:147351755-147351777 ATCTGCCAGCACCTTGATCTTGG - Intergenic
981841107 4:149113274-149113296 ATCCGTCAGTGCCTTGATCTCGG + Intergenic
981863631 4:149387131-149387153 ATCTGCTAATACCTTGATCTTGG - Intergenic
982069314 4:151681755-151681777 ATCTGCCAGCGCCTTTATCTTGG - Intronic
982463960 4:155707139-155707161 ATCTGTATGTAGGTTTTTCTTGG + Intronic
982563098 4:156955313-156955335 ATCCTGAAGTACCTTTATTTTGG + Intronic
982815868 4:159883854-159883876 ATCTGCCAGCACCTTGATCTTGG - Intergenic
982825575 4:160000716-160000738 ATCTGCCAGAACCTTGATCTTGG - Intergenic
982924805 4:161321882-161321904 ATCTGCTAGCACCTTGATCTTGG + Intergenic
982954114 4:161740874-161740896 ATATGTCAGCACCTTGATCTTGG - Intronic
983267493 4:165522761-165522783 ATCTGCCAGGACCTTGATCTTGG + Intergenic
983294464 4:165848692-165848714 ATTTGTCATTATCTTTATCTGGG + Intergenic
983836009 4:172386304-172386326 ATCTGCCAGTACTTTGATCTTGG - Intronic
984428179 4:179614591-179614613 ATCTGCCAGCACCTTGATCTTGG + Intergenic
984561450 4:181275890-181275912 ATCTGCCAGCACCTTGATCTTGG - Intergenic
984608623 4:181813097-181813119 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
984982613 4:185297643-185297665 ATCTGCCAGTACCTTGATCTTGG - Intronic
985158161 4:187014772-187014794 ATCTGCCAGCACCTTGATCTTGG + Intergenic
985944637 5:3168506-3168528 ATCTGTCAGTGCCTTGATTTTGG + Intergenic
986465970 5:8024877-8024899 ATCTGCCAGTGCCTTTATCTTGG - Intergenic
986864539 5:11970865-11970887 ATCTGCAAGTGCCTTCATTTTGG + Intergenic
987041875 5:14070506-14070528 ATATGTCAGTCCCTTGATCTTGG - Intergenic
987213590 5:15709775-15709797 ATCTGCCAGCACCTTGATCTTGG - Intronic
987424431 5:17756589-17756611 CTCTGTAAGTCACTTTCTCTTGG + Intergenic
987483136 5:18484917-18484939 ATCTGTCAGTACCTTAACCTTGG - Intergenic
988077805 5:26374621-26374643 ACATATAAGTACCTTTATCTTGG + Intergenic
988225473 5:28406744-28406766 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
988232112 5:28492544-28492566 ATCTGACAGTACTTTGATCTTGG - Intergenic
988351953 5:30119979-30120001 ACCTGTCAGTACCTTTATCTTGG - Intergenic
988814548 5:34821128-34821150 ATCTCCAAATTCCTTTATCTGGG - Intronic
988958685 5:36347465-36347487 ATCTGCCAGCACCTTGATCTTGG - Intergenic
989381325 5:40812288-40812310 ATCTGCCAGCACCTTTATCTTGG - Intergenic
989476419 5:41879180-41879202 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
989501651 5:42175810-42175832 ATCTGTTAACACTTTTATCTTGG - Intergenic
989503959 5:42203575-42203597 ATCTACTAGTACCTTGATCTTGG + Intergenic
990160073 5:52928041-52928063 ATCTGTTGGTGCCTTGATCTTGG + Intronic
990354444 5:54952099-54952121 ATCTGCAGGTGCCTTAATCTTGG - Intergenic
990532053 5:56683894-56683916 ATCTGCTAGTTCCTTGATCTTGG + Intergenic
990637175 5:57742008-57742030 ATCTGTTAGCACCTTGATCTTGG - Intergenic
990660890 5:58014057-58014079 ATCTGTAAATACATTGAACTGGG + Intergenic
990841299 5:60082373-60082395 ATCTGCCAGCACCTTAATCTTGG + Intronic
991084793 5:62638775-62638797 ACCTGTAAGTGCCTTGACCTTGG + Intergenic
991228326 5:64299181-64299203 ATCTGCAAATTCCTTGATCTTGG + Intronic
991653099 5:68876115-68876137 ATCTGCCAGCACCTTGATCTTGG + Intergenic
991986495 5:72292384-72292406 ATTTCTAAGTACTTTTATTTGGG - Intronic
992357353 5:75999775-75999797 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
992578083 5:78140445-78140467 AACTGTGGGTACCTTGATCTTGG - Intronic
992807689 5:80353778-80353800 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
992849784 5:80795397-80795419 ATCTGCTGGTACCTTGATCTTGG - Intronic
992903334 5:81320902-81320924 ATCTGTTGGCACCTTGATCTTGG - Intergenic
992923777 5:81558341-81558363 ATCTGCCAGCACCTTGATCTTGG - Intronic
993312691 5:86356134-86356156 ATCTGCTAGCACCTTTATCTTGG - Intergenic
993359991 5:86963287-86963309 ATCTGAAAGTTCCTTGACCTTGG - Intergenic
994076726 5:95660143-95660165 ATCTGCCAGTGCCTTGATCTCGG - Intronic
994729972 5:103480552-103480574 ATCTGACAGTGCCTTGATCTTGG + Intergenic
995088770 5:108146949-108146971 ATCTGCTAGTTCCTTGATCTTGG - Intronic
995350296 5:111167226-111167248 ATCTGCAGGCACCTTGATCTTGG + Intergenic
995577510 5:113556336-113556358 ATCTGAATGTACATTTAACTAGG - Intronic
996212222 5:120825400-120825422 ATCTCCAAGTACCATTATATCGG - Intergenic
996379667 5:122850214-122850236 ATCTGCTAGCACCTTGATCTTGG - Intronic
996428268 5:123339342-123339364 GTCTGTCAGCACCTTGATCTTGG - Intergenic
996487785 5:124057163-124057185 ATCTGTATGTTCTTTTGTCTTGG + Intergenic
996742462 5:126813610-126813632 ATCTGCCAGTGCCTTGATCTTGG - Intronic
996773917 5:127114296-127114318 ATCTGTAATTACCTTCTTCCAGG + Intergenic
996832930 5:127759503-127759525 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
996993699 5:129668421-129668443 ATCTATTAGTGCCTTGATCTTGG - Intronic
998071449 5:139200976-139200998 ATCTGTTGGCACCTTGATCTTGG + Intronic
998586235 5:143430701-143430723 ATCTGTCAGTGCCTTGATCTTGG + Intronic
998766258 5:145491216-145491238 ATCTGTTTGCACCTTGATCTTGG - Intronic
1000783484 5:165513742-165513764 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
1000852122 5:166353506-166353528 ATCTGTAAATACTTTTCTTTAGG - Intergenic
1001003425 5:168029067-168029089 ATCTGCAGGTGCCTTGATCTTGG - Intronic
1001175271 5:169462779-169462801 ATCTGCTAGCACCTTGATCTTGG + Intergenic
1001836837 5:174839748-174839770 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1002381833 5:178836230-178836252 ATCTGCAAGTGCTTTGATCTTGG - Intergenic
1002864180 6:1106943-1106965 ATCTGCAGATACCTTGATCTTGG - Intergenic
1003031082 6:2601069-2601091 ATCTGTCAGCACCTCGATCTTGG + Intergenic
1003144462 6:3498275-3498297 ACCTGCTAGTGCCTTTATCTTGG + Intergenic
1003253735 6:4456519-4456541 ATCTGTCAGCACATTGATCTTGG - Intergenic
1003315561 6:5008421-5008443 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1003687599 6:8320100-8320122 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1003787823 6:9506865-9506887 ATCTGCCAGTTCCTTGATCTTGG - Intergenic
1003878906 6:10462701-10462723 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1003951509 6:11120342-11120364 ATCTGCCAGTACCTTGATCTTGG - Intronic
1004197065 6:13514780-13514802 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1004242007 6:13932025-13932047 ATCTGCCAGCACCTTAATCTTGG + Intronic
1004271558 6:14200650-14200672 ATCTGCCAGTACCTTAATCTTGG - Intergenic
1004285115 6:14314511-14314533 ATCTGTCAGCACCTAGATCTTGG - Intergenic
1004371803 6:15059270-15059292 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1004780307 6:18901286-18901308 ACCTGCAAGAACCTTGATCTTGG - Intergenic
1005048886 6:21666016-21666038 TTGTGTAAGCGCCTTTATCTAGG + Intergenic
1005381190 6:25236092-25236114 ATATTTAAATACCTATATCTGGG + Intergenic
1005518264 6:26575007-26575029 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1005603440 6:27450527-27450549 ATCTGCTAGTACCTTGATCTTGG + Intergenic
1005827085 6:29639352-29639374 ATCTGCCAGTGCCTTAATCTTGG - Intergenic
1007038071 6:38696465-38696487 ATCTCCAAGTGCCTTGATCTTGG - Intronic
1007116461 6:39346486-39346508 ATCTGCCAGTGCCTTGATCTTGG + Exonic
1007145413 6:39625115-39625137 ATCTGCCAGTACCTTGATCTTGG + Intronic
1007212922 6:40211357-40211379 ATCTGCTAGCACCTTGATCTTGG - Intergenic
1007319971 6:41021008-41021030 ATCTGTCAGAACCTTGATCTTGG - Intergenic
1007638904 6:43320213-43320235 ATCTGTAAGCACCTTGATCTTGG + Intronic
1008125009 6:47658261-47658283 ATCTATCAGTCCCATTATCTTGG + Intronic
1008140407 6:47825268-47825290 ATATGCAAGTACCTTTAATTGGG + Intronic
1008357319 6:50569887-50569909 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1008780867 6:55103196-55103218 ATCTGTCAGCACCTTGATCTTGG - Intergenic
1008840993 6:55904204-55904226 ATCTTTGAGTACCTCAATCTTGG - Intergenic
1009532573 6:64839689-64839711 ACCTGTCAGCACCTTGATCTTGG - Intronic
1009698699 6:67145556-67145578 ATCTGTCAGTACCCTGATCTTGG - Intergenic
1009841856 6:69087578-69087600 ATCTGCTAGTCCCTTGATCTTGG + Intronic
1009882804 6:69590531-69590553 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1010081837 6:71872698-71872720 ACCTATAAGCACCTTGATCTTGG - Intergenic
1010372866 6:75131921-75131943 ATCTGTAAGTAATTTTGTCATGG - Exonic
1010504246 6:76636959-76636981 ATCTGTCAGTACCTTAATCTTGG + Intergenic
1010581345 6:77600587-77600609 ATCTGCTAGTACCTTGATCTTGG + Intergenic
1010943689 6:81950091-81950113 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1011022724 6:82832463-82832485 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1011384895 6:86785109-86785131 AGCTGTAAATCCCTTTATTTGGG - Intergenic
1011518353 6:88176939-88176961 ATCAGTTAGTACTTTTATATAGG - Intergenic
1011520068 6:88195069-88195091 ATCTGCTAGCACCTTGATCTTGG + Intergenic
1011889900 6:92145075-92145097 ATCTGTGGGTGCCTTGATCTAGG + Intergenic
1012180183 6:96143272-96143294 ATCTGTTGGCACCTTGATCTTGG + Intronic
1012181630 6:96161367-96161389 ATCTGCCAGCACCTTAATCTTGG + Intronic
1012389842 6:98725835-98725857 ATGTGTACGTATCTTTATATAGG + Intergenic
1012760881 6:103298779-103298801 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1013192705 6:107817315-107817337 TTCTGAATGTACCTTTTTCTAGG + Intronic
1013392431 6:109699912-109699934 ATCTGCCAGTGCCTTGATCTTGG - Intronic
1013590114 6:111612654-111612676 ATCTGCTAGCACCTTGATCTTGG + Intergenic
1013632046 6:111995457-111995479 ATCTGTAGGTGCCTTGATCCTGG - Intergenic
1013786701 6:113789368-113789390 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1013857762 6:114594728-114594750 ATCTGTAGGCACCTTGATTTTGG + Intergenic
1013991323 6:116257586-116257608 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1014052873 6:116976163-116976185 GTCTGCCAGTGCCTTTATCTTGG + Intergenic
1014059198 6:117051121-117051143 ATCAGCAAGCACCTTGATCTTGG - Intergenic
1014318083 6:119891924-119891946 ACCTGTCAGTGCCTTAATCTTGG + Intergenic
1014333869 6:120106562-120106584 ATCTGTCAACACCTTGATCTTGG - Intergenic
1014455335 6:121627017-121627039 ACCTGTGAGTGCCTTTCTCTGGG + Intergenic
1014577906 6:123096128-123096150 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1014627063 6:123739416-123739438 ATCTATTGGCACCTTTATCTTGG + Intergenic
1014642151 6:123925937-123925959 ATCTGTCAGCACCTTGATCCTGG - Intronic
1014879141 6:126700858-126700880 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1015249197 6:131109035-131109057 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1015273442 6:131360189-131360211 ATCTGCCAGTACCTTGATCTTGG - Intergenic
1015399708 6:132775239-132775261 ATCTGCCAGTGCCTTAATCTTGG + Intronic
1015719723 6:136228517-136228539 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1016059289 6:139612089-139612111 ATCTGTTGGTTCCTTGATCTTGG + Intergenic
1016115047 6:140270620-140270642 CTCTGCTAGTACCTTGATCTTGG + Intergenic
1016198289 6:141374273-141374295 ATCTGTCAGTGCCTTTATCTTGG + Intergenic
1016210306 6:141524185-141524207 ATCTGCCAGTACCTTGGTCTTGG + Intergenic
1016304050 6:142665100-142665122 ATCTGTGAGCACTTTGATCTTGG - Intergenic
1016345323 6:143106816-143106838 ATCTGTAAGTACCTTTATCTTGG - Intronic
1016599416 6:145841205-145841227 ATGTGTCAGCACCTTGATCTTGG - Intergenic
1016791164 6:148068216-148068238 ATCTGTTGGCACCTTGATCTTGG + Intergenic
1016848462 6:148592570-148592592 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1017555639 6:155563717-155563739 ATCTGCTTGTGCCTTTATCTTGG + Intergenic
1017595662 6:156025980-156026002 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1017638393 6:156466086-156466108 ATTTGAAAGTACCCTTCTCTAGG - Intergenic
1018223082 6:161601261-161601283 ATCTGCCAGCACCTTGATCTTGG - Intronic
1018564163 6:165133867-165133889 ATCTGCCAGTCCCTTAATCTAGG + Intergenic
1018654650 6:166024025-166024047 ATCTGCAAGCACCTTAATCTTGG - Intergenic
1019814746 7:3191273-3191295 ATCTGCCAGCACCTTCATCTTGG + Intergenic
1020549365 7:9581958-9581980 ATCTGTAAGCACCTTGGTCTTGG + Intergenic
1021013070 7:15495700-15495722 ATCTGCTAGAACCTTGATCTTGG - Intronic
1021173943 7:17428295-17428317 ACCTGTCAGCACCTTGATCTTGG + Intergenic
1021334600 7:19383999-19384021 ATCAGTAGGTAACTTTTTCTTGG - Intergenic
1021468230 7:20969967-20969989 ATCTGCCAGTTCCTTAATCTTGG + Intergenic
1021582220 7:22168368-22168390 ATCTGCTAGCACCTTGATCTTGG + Intronic
1022386819 7:29907715-29907737 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1022618082 7:31952973-31952995 GCCTGTAAGTACCTTGATTTGGG + Intronic
1022640777 7:32180600-32180622 ATCTGCCAGCACCTTGATCTTGG + Intronic
1023203892 7:37727537-37727559 ATCTGTTAGTTCTTTTGTCTGGG + Intronic
1023513767 7:40980036-40980058 ATTGGTCAGTACCTTGATCTTGG - Intergenic
1023705728 7:42939977-42939999 ATCTGCCAGCACCTTGATCTGGG + Intronic
1023770403 7:43551818-43551840 ATCTGCTAGTACCTTGATCTTGG - Intronic
1024390601 7:48807285-48807307 ATCTGTTAGCACCTTGATCTTGG + Intergenic
1024483969 7:49895117-49895139 ATCTGCAAGTGCCTTTATGTTGG - Intronic
1024566592 7:50686321-50686343 ATCTGGGAGCACCTTGATCTTGG + Intronic
1024918655 7:54533193-54533215 ATCTGCCAGTGCCTTCATCTTGG + Intergenic
1026421452 7:70241453-70241475 AGTAGTAAGTACTTTTATCTAGG - Intronic
1026491361 7:70866613-70866635 ATCTGCAAGCACCTTGATCTTGG - Intergenic
1026883687 7:73923383-73923405 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1027617638 7:80443583-80443605 ATCCGCCAGTACCTTGATCTTGG - Intronic
1027844927 7:83360916-83360938 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1028462804 7:91115282-91115304 ATCTGCTGGCACCTTTATCTTGG - Intronic
1028786924 7:94805681-94805703 ATCTGTTGGCACCTTGATCTTGG + Intergenic
1029259469 7:99291988-99292010 ATCTGTAACTTTCTTTAGCTGGG - Intergenic
1029970823 7:104787449-104787471 ATCTGTTGGTGCCTTAATCTTGG - Intronic
1030175322 7:106647122-106647144 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1030535598 7:110762614-110762636 TTCTTTAAGTAGCTTTGTCTGGG + Intronic
1030866192 7:114704330-114704352 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1031335292 7:120522436-120522458 ATCTTTAAATATCTCTATCTTGG - Intronic
1031482342 7:122293522-122293544 ATCTGTCAACACCTTGATCTTGG + Intergenic
1031555896 7:123175634-123175656 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1031624825 7:123980333-123980355 ATCTCAAAGCACCTTGATCTTGG - Intergenic
1032342656 7:131089795-131089817 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1032684755 7:134222116-134222138 TTCTGTGAGTACCTTTCTCCTGG + Intronic
1032740373 7:134732556-134732578 ATCTGCCAGTACCTTGATCTTGG + Intergenic
1032892424 7:136212835-136212857 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
1033266220 7:139889615-139889637 ATCTGTTGGTTCCTTGATCTTGG - Intronic
1033520921 7:142159583-142159605 ATCTGCCAGCACCTTGATCTTGG - Intronic
1033690547 7:143732413-143732435 ATCTTTAAGTATCTTTAACCAGG + Intergenic
1033730689 7:144176005-144176027 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1033832735 7:145272908-145272930 ATCTACCAGTACCTTAATCTTGG + Intergenic
1034010269 7:147522011-147522033 ATCTGCCAGCACCTTGATCTTGG - Intronic
1035811370 8:2494327-2494349 TCTTGTAATTACCTTTATCTAGG + Intergenic
1035920973 8:3675715-3675737 ATCTATAAGCACCTTGATCTTGG + Intronic
1035937903 8:3862978-3863000 ATCTGTTGGTACCTTGATATTGG - Intronic
1035983342 8:4397986-4398008 ATTTTTAAATACCTTTGTCTAGG + Intronic
1036508340 8:9377042-9377064 ACCTGTAAGTGCATTTAACTGGG - Intergenic
1036526402 8:9538963-9538985 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1036559766 8:9891466-9891488 ATCTGCCAGTGCCTTCATCTTGG + Intergenic
1036576327 8:10031066-10031088 ATCTGCTAGCACCTTGATCTTGG - Intergenic
1036586860 8:10132528-10132550 ATCTGCCAGTGCCTTGATCTTGG - Intronic
1037241032 8:16777873-16777895 ATCTGCCAGCACCTTGATCTCGG + Intergenic
1037463853 8:19139814-19139836 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1037702347 8:21286504-21286526 ATCTGTACGTATCTTCACCTTGG - Intergenic
1037732094 8:21534631-21534653 TACTGTCAGTACCTTGATCTTGG - Intergenic
1037740650 8:21606381-21606403 AGCTGCCAGTACCTTGATCTTGG + Intergenic
1038028023 8:23609562-23609584 ATCTGTCAGCACCTTCGTCTTGG - Intergenic
1038141208 8:24847376-24847398 ATCTGTCAGTGTCTTCATCTTGG + Intergenic
1038375947 8:27040566-27040588 ATCTGCCAGTTCCTTAATCTTGG - Intergenic
1038484337 8:27922949-27922971 ATCTGCTGGCACCTTTATCTTGG + Intronic
1038512205 8:28149085-28149107 ATATGCAAGTACCTTAATCTTGG + Intronic
1038684553 8:29704454-29704476 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1038751263 8:30298114-30298136 ACCTGTCAGCACCTTGATCTTGG + Intergenic
1038815119 8:30894966-30894988 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1038815446 8:30898436-30898458 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1038888126 8:31688408-31688430 ATCTGCTGGTACCTTGATCTTGG + Intronic
1039079241 8:33719654-33719676 ATCTGCCAGTACCTTCATCTTGG - Intergenic
1039273566 8:35909734-35909756 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1039627752 8:39072030-39072052 TTCTGCAGGTACCTTTATCTAGG - Intronic
1040542634 8:48373769-48373791 ATCTGTCAGCATCTTGATCTTGG - Intergenic
1040751872 8:50719425-50719447 ATCTGCCAGCACCTTGATCTTGG + Intronic
1040792337 8:51247064-51247086 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1040862417 8:52013272-52013294 ATCTGCAAATACATTTAACTAGG - Intergenic
1041036804 8:53799881-53799903 ATCTGCTAGTGCCTTCATCTTGG + Intronic
1041049227 8:53916803-53916825 ATCTGCCAGTGCCTTGATCTTGG - Intronic
1041215170 8:55593276-55593298 ATTTGTGAGTGCCTTGATCTTGG - Intergenic
1041333976 8:56759013-56759035 ATCTGCTAGCACCTTGATCTTGG + Intergenic
1041737723 8:61129585-61129607 ATCTGTCAATTCCTTGATCTTGG - Intronic
1041756601 8:61320604-61320626 ATCTGTTAGTACCTTGATCTTGG - Intronic
1041862420 8:62529639-62529661 ATCTGTCAGTGCCATGATCTTGG + Intronic
1041871167 8:62635722-62635744 ATCTGCATGAACCTTCATCTTGG + Intronic
1041909333 8:63071817-63071839 ATCTGCCAGTGCCTTGATCTTGG + Intronic
1042003234 8:64150251-64150273 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1042329172 8:67560012-67560034 ATCTGTTGGCACCTTGATCTTGG + Intronic
1042329446 8:67562787-67562809 ATCTGTTGGCACCTTGATCTTGG + Intronic
1042350195 8:67769215-67769237 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1042703924 8:71646880-71646902 ATCTGCCAGTACCTTGATCTAGG - Intergenic
1042865682 8:73355115-73355137 ATCTGCCAGTACCTTGATCTTGG - Intergenic
1042970958 8:74408583-74408605 ATTTGTCAGTACCTTGATCTTGG + Intronic
1043202462 8:77387507-77387529 ATCTTCAAGCACCTTGATCTTGG + Intergenic
1043347812 8:79320318-79320340 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1043371891 8:79604433-79604455 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1043487314 8:80710729-80710751 ATCTGCCAGGACCTTGATCTTGG + Intronic
1043867844 8:85395900-85395922 ATCTGCTGGTACCTTGATCTTGG - Intronic
1044085204 8:87935344-87935366 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1044092590 8:88020735-88020757 ATCTGTTAGAACCTCTATCTCGG - Intergenic
1044293649 8:90502445-90502467 GTCTGTAGGCACCTTTACCTTGG - Intergenic
1044804022 8:95986594-95986616 ATCTGCCAGCACCTTTATTTTGG - Intergenic
1044926266 8:97211366-97211388 ATCTGCCAGTACCTTGATTTTGG - Intergenic
1044937336 8:97305768-97305790 ATCTGCCAGCACCTTGATCTAGG - Intergenic
1045399236 8:101795408-101795430 ATCTGTAGGAGCCTTGATCTTGG - Intronic
1045407630 8:101882462-101882484 ATCTGCCAGCACCTTAATCTTGG + Intronic
1045554293 8:103200676-103200698 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1045675353 8:104601438-104601460 ATCTGTCAGCATCTTAATCTTGG - Intronic
1045692900 8:104777991-104778013 ATCTGTTAGCACCTTGATCTTGG - Intronic
1045778806 8:105839165-105839187 ATCTGCTAGTACCTTGACCTTGG + Intergenic
1045950009 8:107840804-107840826 ATCTGCAAGAACCTTTGTCTTGG + Intergenic
1046186087 8:110721468-110721490 AACTGTAAGTGCCTTGATGTTGG - Intergenic
1046299741 8:112272121-112272143 ATCTGCTAGCACCTTGATCTTGG + Intronic
1046357814 8:113110864-113110886 ATCTGCCAGTGCCTTCATCTTGG - Intronic
1046381892 8:113461474-113461496 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1046623170 8:116549492-116549514 ACCTTTCAGCACCTTTATCTTGG + Intergenic
1047175366 8:122535776-122535798 ATCTGAAGGCACCTTGATCTGGG - Intergenic
1047401225 8:124549185-124549207 TTCTGTTAGGACATTTATCTTGG + Intronic
1047539240 8:125748314-125748336 ATCTGTTAGCACCTTCATCTTGG - Intergenic
1047543294 8:125791547-125791569 ATCCGCTGGTACCTTTATCTTGG + Intergenic
1047606471 8:126479762-126479784 ATTTGCTAGTACCTTGATCTTGG - Intergenic
1047640197 8:126810862-126810884 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1047777962 8:128089246-128089268 ATCTGTCAGCACCTTGATCTTGG - Intergenic
1048049136 8:130800820-130800842 ATCTGCCAGTACCTTGATCTTGG - Intronic
1048314373 8:133351207-133351229 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1048434159 8:134400284-134400306 ATCTGCCAGCAACTTTATCTTGG + Intergenic
1048477007 8:134752669-134752691 ACCTGCCAGTACCTTGATCTTGG - Intergenic
1048485391 8:134843242-134843264 ATATGTCAGCACCTTGATCTCGG + Intergenic
1048493026 8:134912231-134912253 CTCTGTCAGTACCTTGACCTTGG + Intergenic
1048565913 8:135597113-135597135 ATCTGTAGGTGTCTTGATCTTGG - Intronic
1048925514 8:139267564-139267586 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1049502875 8:142977077-142977099 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1049723624 8:144134423-144134445 ATCTGTCAGTACTTTGATCCTGG - Intergenic
1050063103 9:1731036-1731058 ATCTGCAAGGGCCTTGATCTTGG - Intergenic
1050149496 9:2605185-2605207 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1050367260 9:4884180-4884202 ATCTGCCAGTGCCTTGATCTTGG - Intronic
1050498543 9:6269612-6269634 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1050615524 9:7398133-7398155 ATCTGCTGGTGCCTTTATCTTGG - Intergenic
1050844857 9:10202908-10202930 ATCTGTGGGTACCTTGATCTTGG + Intronic
1050877597 9:10658774-10658796 ATCTGTTAGTGCCTTGATCTTGG + Intergenic
1051019936 9:12531700-12531722 AATTGTCAGTACCTTTACCTCGG + Intergenic
1051365611 9:16319501-16319523 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1051375247 9:16395769-16395791 ATGTGTAAGTACATTTTCCTTGG - Intergenic
1051481248 9:17563825-17563847 ATCTGCTAGCACCTTGATCTTGG + Intergenic
1051483431 9:17583503-17583525 ATCTGTTAGTGCCTTCATCTTGG + Intronic
1051676177 9:19560582-19560604 ATCTGCCAGAACCTTGATCTTGG + Intronic
1051689407 9:19694309-19694331 ATCTGTAATAACCTTGATTTAGG - Intronic
1051884265 9:21873575-21873597 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1052202440 9:25799253-25799275 ATCAGTAAGTACCTTGATCTTGG - Intergenic
1052341767 9:27370631-27370653 ATCTGTCAGTGCCTTGATCTTGG + Intronic
1053048831 9:34941640-34941662 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1053627959 9:39896183-39896205 ATTTGTCAGTTCGTTTATCTAGG - Intergenic
1053778101 9:41570142-41570164 ATTTGTCAGTTCGTTTATCTAGG + Intergenic
1054215928 9:62354519-62354541 ATTTGTCAGTTCGTTTATCTAGG + Intergenic
1054671554 9:67800830-67800852 ATTTGTCAGTTCGTTTATCTAGG - Intergenic
1054733654 9:68728253-68728275 ATCTGTCAGCACCTTGATCTTGG - Intronic
1054999665 9:71434411-71434433 ATCTGCCAGAACCTTGATCTTGG + Intronic
1055090746 9:72363835-72363857 ACCTATATGTTCCTTTATCTTGG + Intronic
1055096635 9:72421175-72421197 ATGTGTAAGCACCTTGATCTTGG - Intergenic
1055176733 9:73327678-73327700 ATCTGTAGGCACCTTGATCTTGG - Intergenic
1055511452 9:76999462-76999484 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1055876988 9:80955028-80955050 ATCTGACAGTGCCTTAATCTTGG - Intergenic
1056485623 9:87054390-87054412 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1056497735 9:87176747-87176769 ATCTGCCAGTACCTTGATCTTGG - Intergenic
1056516122 9:87352000-87352022 ATCTGCCAGTACCTTGATCTTGG + Intergenic
1056535479 9:87524125-87524147 CTCTGTAAGAACCTCTATCGGGG - Intronic
1057056296 9:91963772-91963794 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1057969856 9:99544495-99544517 ATCTGTCTGTGCCTTGATCTTGG - Intergenic
1058188435 9:101883970-101883992 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1058404860 9:104661366-104661388 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1058600085 9:106659836-106659858 ATCTGCAAGTGCCTTCATTTAGG - Intergenic
1058718114 9:107740083-107740105 ACCTGTAACTACCTTCTTCTCGG + Intergenic
1058890749 9:109358580-109358602 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1058894023 9:109384266-109384288 ATTTGTGAGTCCCTTAATCTGGG - Intronic
1059502695 9:114768558-114768580 ATCTGCCAGAACCTTGATCTTGG + Intergenic
1059618566 9:115977762-115977784 ATCTGTCATCACCTTGATCTTGG + Intergenic
1059872574 9:118594405-118594427 ATCTGTTGGCACCTTGATCTTGG - Intergenic
1059923388 9:119182671-119182693 ATCTACCAGTACCTTGATCTCGG + Intronic
1060316739 9:122518378-122518400 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1060853908 9:126899810-126899832 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1061249430 9:129417823-129417845 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1062131652 9:134897887-134897909 ATCTGTGAGTATCTTTGTCTGGG + Intergenic
1062304568 9:135896972-135896994 ATCTGTTGGCACCTTAATCTTGG + Intronic
1186320686 X:8421147-8421169 ATCTGTCTGTGCCTTGATCTTGG + Intergenic
1186645042 X:11497659-11497681 ATCTGTCAGCACCTTGATTTTGG + Intronic
1186682212 X:11887050-11887072 TTCTTTGAGTACCTATATCTTGG - Intergenic
1186987064 X:15028557-15028579 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1187073014 X:15907443-15907465 ATCTGCAAGGGCCTTGATCTTGG - Intergenic
1187774625 X:22742457-22742479 ATTAGTAAGTACCATTAGCTGGG - Intergenic
1187790653 X:22946415-22946437 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1187968305 X:24634377-24634399 ATCCACAAATACCTTTATCTAGG - Intronic
1188293503 X:28417490-28417512 ATCTGCTAGTACCTTGCTCTTGG - Intergenic
1188377394 X:29448813-29448835 ATCTATCAGCACCTTGATCTTGG - Intronic
1188467096 X:30494036-30494058 ATCTGCTAGTACCTTGATCTTGG - Intergenic
1188801967 X:34543594-34543616 ATCTGCTAGCACCTTGATCTTGG - Intergenic
1188930635 X:36106473-36106495 ACCTGCCAGTACCTTAATCTTGG - Intronic
1188936727 X:36185137-36185159 ACCTGCCAGTGCCTTTATCTTGG - Intergenic
1189068381 X:37836432-37836454 ATCTGTCAGTGCCTTGATCTTGG + Intronic
1189366853 X:40395457-40395479 ATCTGACAGTGCCTTGATCTTGG - Intergenic
1189526448 X:41827373-41827395 ATCTGCTGGTACCTTGATCTTGG - Intronic
1189531378 X:41887443-41887465 ATATTTAAGTGCCTTTTTCTTGG - Intronic
1189554192 X:42125436-42125458 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1189569767 X:42284013-42284035 ATCTGCAGGCACCTTGATCTTGG + Intergenic
1189773492 X:44449333-44449355 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1189810195 X:44774397-44774419 TCCTGTAAGTTCCTTCATCTAGG + Intergenic
1189824453 X:44902811-44902833 ATCTGGGAGTGCCTTGATCTTGG - Intronic
1189916150 X:45857677-45857699 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1190018464 X:46850128-46850150 ATCTGCTAGCACCTTGATCTTGG - Intronic
1190156417 X:47996894-47996916 ATCAGTCAGTACCTTAATCTGGG + Intronic
1190421601 X:50290291-50290313 ATCTGCCAGCACCTTGATCTTGG - Intronic
1190435068 X:50416161-50416183 ACCTGCCAGTACCTTGATCTTGG + Intronic
1190550445 X:51574308-51574330 ATCTGCTAGTACCTTGATCATGG + Intergenic
1190579768 X:51881055-51881077 ATCTGCCAGTGCCTTTGTCTTGG - Intronic
1190762355 X:53447074-53447096 ATCTGCCAGTGCCTTGATCTTGG + Intergenic
1191652596 X:63557276-63557298 ATCTGCCACTACCTTGATCTTGG + Intergenic
1192616817 X:72633432-72633454 ACCTGTCAGCACCTTGATCTTGG + Intronic
1192896345 X:75446680-75446702 AGCTGTTGGTACCTTGATCTTGG - Intronic
1193952535 X:87818264-87818286 TTCTGTTAGCACCTTCATCTAGG - Intergenic
1194675978 X:96794055-96794077 ATCTGTTAGTATCCTGATCTTGG - Intronic
1194817993 X:98468949-98468971 ATCTGCCAGTGCCTTTATCTTGG - Intergenic
1194827755 X:98583510-98583532 ACCTGTCAGTGCCTTGATCTTGG + Intergenic
1195294466 X:103462124-103462146 ATCTGTAATTATCTTTATCTTGG - Intergenic
1195498302 X:105564022-105564044 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1195513540 X:105745493-105745515 ATCTGTTAGTACCTTGATCTTGG - Intronic
1195950729 X:110269945-110269967 CTCTGCCAGTACCTTAATCTTGG - Intronic
1195995407 X:110726448-110726470 ATCTGATGGTACCTTGATCTTGG + Intronic
1196224706 X:113152169-113152191 ATCTGTTAGCACCTTGATCTTGG + Intergenic
1196255388 X:113512060-113512082 ATCTGCTAATACCTTGATCTTGG + Intergenic
1196327170 X:114420141-114420163 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
1196577207 X:117333225-117333247 ATCTGCTTGTACCTTGATCTTGG + Intergenic
1196580621 X:117374897-117374919 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1197106160 X:122719103-122719125 ATCTGCAGGCACCTTGATCTTGG - Intergenic
1197182601 X:123552345-123552367 ATCTGCCAGTGCCTTGATCTTGG - Intergenic
1197718628 X:129728667-129728689 ATCTGCTAGCACCTTGATCTTGG + Intergenic
1198135078 X:133741210-133741232 ATCTGCCAGAACCTTGATCTTGG + Intronic
1198180629 X:134204973-134204995 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
1198601099 X:138285076-138285098 ATCTGCTAGTACCTTGGTCTTGG - Intergenic
1198787369 X:140303606-140303628 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1198839857 X:140844731-140844753 ATCTGTCAGCAGCTTAATCTTGG + Intergenic
1198851995 X:140974672-140974694 ATCTGCTGGCACCTTTATCTTGG + Intergenic
1198885788 X:141334602-141334624 ATCTGTCTGCACCTTGATCTTGG + Intergenic
1199949437 X:152695721-152695743 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1199951609 X:152711382-152711404 ATCTGCCAGCACCTTGATCTTGG + Intergenic
1199954261 X:152730583-152730605 ATCTGCCAGCACCTTGATCTTGG + Intronic
1199958074 X:152757066-152757088 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1199960239 X:152772728-152772750 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1200325988 X:155239945-155239967 ATCTGCCAGCACCTTGATCTTGG - Intergenic
1200737039 Y:6811166-6811188 ATCTGTTGGTATCTTGATCTTGG - Intergenic
1201885120 Y:18873745-18873767 ATCTGTAAATACCATCACCTTGG - Intergenic