ID: 1016349895

View in Genome Browser
Species Human (GRCh38)
Location 6:143155757-143155779
Sequence CCTCTTCACCAGACTATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016349895_1016349909 21 Left 1016349895 6:143155757-143155779 CCACACATAGTCTGGTGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1016349909 6:143155801-143155823 GGGACTGGGAAGAGCATTTGGGG 0: 1
1: 0
2: 2
3: 30
4: 359
1016349895_1016349902 1 Left 1016349895 6:143155757-143155779 CCACACATAGTCTGGTGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1016349902 6:143155781-143155803 TCCCTGGAAGAAACTGGAAGGGG 0: 1
1: 0
2: 3
3: 37
4: 360
1016349895_1016349908 20 Left 1016349895 6:143155757-143155779 CCACACATAGTCTGGTGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1016349908 6:143155800-143155822 GGGGACTGGGAAGAGCATTTGGG 0: 1
1: 0
2: 5
3: 25
4: 333
1016349895_1016349907 19 Left 1016349895 6:143155757-143155779 CCACACATAGTCTGGTGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1016349907 6:143155799-143155821 AGGGGACTGGGAAGAGCATTTGG No data
1016349895_1016349901 0 Left 1016349895 6:143155757-143155779 CCACACATAGTCTGGTGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1016349901 6:143155780-143155802 GTCCCTGGAAGAAACTGGAAGGG No data
1016349895_1016349900 -1 Left 1016349895 6:143155757-143155779 CCACACATAGTCTGGTGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1016349900 6:143155779-143155801 GGTCCCTGGAAGAAACTGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 269
1016349895_1016349905 6 Left 1016349895 6:143155757-143155779 CCACACATAGTCTGGTGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1016349905 6:143155786-143155808 GGAAGAAACTGGAAGGGGACTGG No data
1016349895_1016349899 -5 Left 1016349895 6:143155757-143155779 CCACACATAGTCTGGTGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1016349899 6:143155775-143155797 AGAGGGTCCCTGGAAGAAACTGG 0: 1
1: 0
2: 2
3: 26
4: 303
1016349895_1016349906 7 Left 1016349895 6:143155757-143155779 CCACACATAGTCTGGTGAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1016349906 6:143155787-143155809 GAAGAAACTGGAAGGGGACTGGG 0: 1
1: 0
2: 2
3: 43
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016349895 Original CRISPR CCTCTTCACCAGACTATGTG TGG (reversed) Intronic
903428592 1:23273778-23273800 CCTTTTCACCAGACTATAATTGG - Intergenic
903480125 1:23646967-23646989 CATCTTCACCAGACTTGGGGAGG - Intergenic
904260777 1:29286517-29286539 CCTATGCACCAGACTCAGTGAGG - Intronic
908489649 1:64630628-64630650 AGTCTTCACCAGAATGTGTGGGG - Intronic
909331393 1:74416111-74416133 CCTTTTCACCAGAGTATCTCTGG + Intronic
911532141 1:99056405-99056427 GCTCTTTACCAGACTCTGTAGGG - Intergenic
911719056 1:101170058-101170080 ACTCTTCACCAGTCTGTGTTGGG + Intergenic
918865218 1:189888059-189888081 CCTCTTTATCAGACTATTTAGGG + Intergenic
919981462 1:202644769-202644791 CCGGTTCCCCAGACTCTGTGGGG - Intronic
922612568 1:226940982-226941004 CCTCTTCTCCAAACTCTGGGGGG + Intronic
1066686958 10:37990750-37990772 CCTCTTCAGAAGACAGTGTGGGG - Intergenic
1067767805 10:49100934-49100956 CCTCTTCAACAGACAGTGTAGGG + Intronic
1068202888 10:53806632-53806654 CTTCATCATCAGACTGTGTGTGG + Intronic
1069026297 10:63545984-63546006 ACTCTTCCCCAGAATCTGTGTGG - Intronic
1071033615 10:81215446-81215468 CCTCTTCCCTTGACTAAGTGAGG + Intergenic
1074109653 10:110413632-110413654 CCTCTCCAGCAGACTAGCTGGGG + Intergenic
1076431406 10:130405549-130405571 CCTCTTCTTCTGACTATTTGGGG - Intergenic
1079421996 11:20302203-20302225 CCTCTCTAACACACTATGTGGGG - Intergenic
1080399278 11:31919243-31919265 CCTTTTCACGATCCTATGTGTGG - Intronic
1082959182 11:58902640-58902662 CCACCTCACCCGACCATGTGAGG + Intronic
1084059250 11:66659048-66659070 CCTAACCACCAGACTATCTGGGG + Intronic
1084270825 11:68028200-68028222 CCTCTTCTCCTGAATATGGGTGG - Exonic
1085453849 11:76654946-76654968 CCTCCTCACCACACTCTCTGAGG + Intergenic
1086482574 11:87258695-87258717 TCTCTTCATGAGACAATGTGGGG + Intronic
1087500637 11:98948834-98948856 TCTCTTTACCAGACTAAGTAAGG - Intergenic
1090824061 11:130371204-130371226 CCTATTCACAAGACTCTCTGGGG + Intergenic
1091305805 11:134535415-134535437 CCCCTTCCCCACACTGTGTGGGG + Intergenic
1098768017 12:74514578-74514600 CCTCTTCACCAAGCCATGAGTGG - Intergenic
1102394867 12:112576694-112576716 TCTCTCCACCAAATTATGTGGGG - Intronic
1102574810 12:113849669-113849691 CCTCTCCAGCAGACCATCTGGGG - Intronic
1102873817 12:116434463-116434485 CCTCCTCAGAAGAATATGTGTGG - Intergenic
1103437980 12:120941755-120941777 CATCTGCATCAGACTCTGTGGGG - Intergenic
1103749171 12:123147732-123147754 CTTCTTTGCCACACTATGTGTGG - Intronic
1104230270 12:126877751-126877773 CCACTTCACCTGTGTATGTGTGG - Intergenic
1104312251 12:127663905-127663927 CCTCTTCACCAGCCTCTGCCTGG + Intergenic
1109941586 13:69374344-69374366 CAGCTTTACCAGACTGTGTGTGG + Intergenic
1112577625 13:100650477-100650499 CCTCTTCACCACTCTATGCCTGG + Intronic
1114163298 14:20192769-20192791 TATCTTCCTCAGACTATGTGGGG + Intergenic
1115464879 14:33704061-33704083 CCACTTCAAAGGACTATGTGAGG + Intronic
1115795406 14:36930018-36930040 CCTCTTCACATGACTATCTTGGG - Intronic
1117089166 14:52232743-52232765 CATCTTCACTAGATTATTTGTGG + Intergenic
1117735980 14:58769056-58769078 TCTCTTCACCAGACTTTTTAGGG + Intergenic
1118155763 14:63239819-63239841 CTTCTTTACCAATCTATGTGTGG + Intronic
1119310567 14:73642988-73643010 CCTGTTCACCAGAGAATGTGTGG - Intergenic
1122471612 14:101971026-101971048 CCCGTTCACCAGACTTTGAGAGG + Intronic
1124497151 15:30193508-30193530 CCAGTTCCCCAGACTCTGTGGGG - Intergenic
1124746423 15:32345139-32345161 CCAGTTCCCCAGACTCTGTGGGG + Intergenic
1125452397 15:39823145-39823167 CCTCTTCTCTAGACTATTTTAGG + Intronic
1125883901 15:43214384-43214406 ACGGTTCACCAGACTATGAGCGG - Intronic
1126366506 15:47899992-47900014 GATTTTCACCAGACTATGTTGGG + Intergenic
1133027399 16:2994794-2994816 TCTCTCCACCAGGCTATGTGGGG + Intergenic
1133028012 16:2997041-2997063 TCTCTTCACCAGGCTATTTGGGG + Intergenic
1133812210 16:9169550-9169572 CTTCTTCACAAGACTGTGGGAGG - Intergenic
1143964694 17:10748718-10748740 CCTCTTCTCCAGACTGTCTGGGG + Intergenic
1146219392 17:31005156-31005178 CTGCTTCACCAGAGTGTGTGAGG - Intergenic
1148864662 17:50622318-50622340 CGTCTTCACCAAACTCAGTGGGG + Intronic
1150137086 17:62702010-62702032 GTTCTGCACCAGGCTATGTGGGG - Intronic
1153042218 18:823857-823879 CATCTTCACCACAATCTGTGAGG + Intergenic
1156487168 18:37473756-37473778 CATCTCCACCAGGCTGTGTGAGG + Intronic
1159796391 18:72849381-72849403 CTTCATCAACAGACTATTTGTGG - Intronic
1166389134 19:42399298-42399320 CCTCTTCAACCCACTATGTCTGG + Intergenic
926019916 2:9485740-9485762 CCTCTTCACCAGTATCTGTGTGG - Intronic
928163018 2:28946442-28946464 CCTCTTCAGAAGACTCTGTAAGG - Exonic
928747273 2:34430213-34430235 CCACTTCTCAAGATTATGTGAGG - Intergenic
929444749 2:41992918-41992940 GCTCTTCCCCAGACACTGTGTGG - Intergenic
930564182 2:52999043-52999065 CCTCTTTCCCAGTCTGTGTGAGG - Intergenic
930587653 2:53287994-53288016 ACTCTTCAACAGTCTGTGTGAGG - Intergenic
931753548 2:65351475-65351497 CCACTTCACCAGACCTTGAGAGG + Intronic
935543723 2:104378621-104378643 CCCCTCCAACAGACTAGGTGAGG - Intergenic
938687057 2:133748874-133748896 CATCTTCTCCAGACCAGGTGAGG + Intergenic
940589606 2:155704671-155704693 CTTCTTTACCTGACTATGAGTGG - Intergenic
943306006 2:186263759-186263781 CCTGTTCACCACACTCTGAGAGG + Intergenic
946030021 2:216696143-216696165 CCTCTTCTCCAGACTTTTAGGGG - Intergenic
1173164281 20:40675632-40675654 CCCCTTCAGAAGATTATGTGAGG + Intergenic
1173447038 20:43128517-43128539 CCTTTTCACCTGACTATTTTGGG - Intronic
1173469255 20:43309832-43309854 CCTCTTCCTCAGCCTTTGTGTGG + Intergenic
1174180567 20:48671879-48671901 CCACTTCAGCAGCCTATCTGTGG - Intronic
1174471479 20:50764347-50764369 CCTCTTCAGGAGAGTTTGTGTGG + Intergenic
1174803855 20:53589904-53589926 CCTCTTCTCCAGATTCTGCGGGG - Intronic
1176267306 20:64216951-64216973 CTTCCTCACCAGACGCTGTGAGG + Intronic
1181843646 22:25687817-25687839 CCTCTAGACCAGACTCTGCGGGG + Intronic
949496612 3:4638308-4638330 CCCTTTCACCAGTCTATGTTTGG + Intronic
954813982 3:53266006-53266028 CCTGGTCACCAAAATATGTGAGG + Intergenic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
956284313 3:67592606-67592628 CCTATTCCCCAGACTATTTGGGG - Intronic
957865165 3:86013460-86013482 CCTCTTCACCAGAATTTATCTGG - Intronic
960044094 3:113179631-113179653 CCTCTTCACAAGCCCATGTGGGG - Intergenic
960950185 3:122994030-122994052 CCTCTTCACCAGGCTTCCTGCGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961765120 3:129204182-129204204 CATCTTCACATGACTTTGTGAGG + Intergenic
963342045 3:144048137-144048159 TCCCTTCACCAGACTATGTTAGG - Intronic
966527298 3:180933583-180933605 CCTCTTCGCCAGAACATGTATGG + Intronic
969598162 4:8160407-8160429 CGTCCTCACCAGGCTGTGTGGGG - Intergenic
973029968 4:45325318-45325340 CCTCTTCACCAGAATTTATCTGG + Intergenic
973278537 4:48335460-48335482 CCTCTTGCCCAGACTCTGTTCGG - Intergenic
978068537 4:104437025-104437047 TCTTATCACCAGACTTTGTGTGG + Intergenic
979608288 4:122662832-122662854 CCTCTTCCCTAGACTATTTTTGG + Intergenic
980938084 4:139245320-139245342 CCTCTTGACCACAAAATGTGAGG + Intergenic
981365707 4:143900326-143900348 CCTTTTCACCAGAGTGTATGAGG - Intronic
981375804 4:144014133-144014155 CCTTTTCACCAGAGTGTATGAGG - Intronic
984198346 4:176687344-176687366 ACTCTTCCCCAGCCAATGTGGGG - Exonic
985826773 5:2197905-2197927 CCTCTTCATCAGAGACTGTGGGG - Intergenic
986042327 5:4005530-4005552 CCTCTTCAGGAGACTCTCTGTGG + Intergenic
994488970 5:100417321-100417343 CCTCTGCACCAGAGGAGGTGTGG - Intergenic
1002724796 5:181287334-181287356 CCTCTTCCACACACTATTTGAGG + Intergenic
1002944232 6:1745625-1745647 CTTCTCCATCAGACTATCTGTGG + Intronic
1003946449 6:11080458-11080480 TCTCTTCCCCAGAGGATGTGGGG + Intergenic
1008293753 6:49752167-49752189 CCTCTTCAACTCACTATATGAGG - Intergenic
1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG + Intronic
1016349895 6:143155757-143155779 CCTCTTCACCAGACTATGTGTGG - Intronic
1017350836 6:153440298-153440320 CCTCTGCCCCAAAATATGTGTGG + Intergenic
1018146253 6:160892086-160892108 CCTCTGCCCCAAAATATGTGTGG - Intergenic
1020187830 7:5972284-5972306 CCCCTTCTCCAGACTGTGGGCGG - Intergenic
1020295087 7:6752486-6752508 CCCCTTCTCCAGACTGTGGGCGG + Intergenic
1023914621 7:44579616-44579638 GCTCTTCACGATACTGTGTGGGG + Exonic
1025776816 7:64568069-64568091 CTTCTCCACCAGACTCTGAGTGG + Intergenic
1026811425 7:73469532-73469554 CCTCATCACCAGAGACTGTGTGG + Exonic
1031654930 7:124343149-124343171 CCTCTTCACCACACACTGTGGGG + Intergenic
1032223165 7:130009383-130009405 TCTCCTCACCAGACTGTCTGTGG - Intergenic
1034887269 7:154807287-154807309 CCACTGCACCAGGCTCTGTGGGG - Intronic
1038494075 8:27989642-27989664 CCTCTCCTCCAGCCTATGGGAGG + Intronic
1041859050 8:62490553-62490575 CCTCTCTACCAGACTTTCTGAGG - Intronic
1044677882 8:94748091-94748113 TCTCTTCCCCTGACAATGTGTGG - Intronic
1044776344 8:95693009-95693031 CCACTTCACCTGACTAGATGAGG - Intergenic
1047603596 8:126452049-126452071 TCTCTCCACAAGACTATTTGAGG - Intergenic
1048157665 8:131975294-131975316 CTTCTTTACCAGACAATGTGTGG + Intronic
1051371765 9:16364984-16365006 CCTCCCCACCTGACTCTGTGGGG + Intergenic
1053886972 9:42650809-42650831 CCTCTTCCACACACTATTTGAGG + Intergenic
1054225992 9:62458259-62458281 CCTCTTCCACACACTATTTGAGG + Intergenic
1055091291 9:72366256-72366278 CCTCTTCTCCATTCTATATGTGG - Intergenic
1056498632 9:87186235-87186257 CCACTTCACCAGTCTATGGAGGG + Intergenic
1056820453 9:89838056-89838078 CGTCTTCTCCAGGCCATGTGGGG - Intergenic
1058678969 9:107425178-107425200 CCTCTGAACCAGACTCTGGGGGG - Intergenic
1059519009 9:114922342-114922364 CCACCTTACAAGACTATGTGAGG - Intronic
1061152287 9:128835770-128835792 CCTCTTCACCTGGCTCTGCGTGG + Exonic
1191930512 X:66366535-66366557 CTTCTTCACCAGCAAATGTGTGG + Intergenic
1193239744 X:79154143-79154165 CCTTTTCAACAGCCTATGTATGG - Intergenic
1197706563 X:129638755-129638777 CCTCCTCACCAGACTAGGCATGG - Intergenic
1199264331 X:145812805-145812827 CCTCTTCACCTGATTATGGTAGG - Intergenic