ID: 1016354798

View in Genome Browser
Species Human (GRCh38)
Location 6:143206848-143206870
Sequence CTGGCCTAGCTCATTTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016354798_1016354802 30 Left 1016354798 6:143206848-143206870 CCAACTTAAATGAGCTAGGCCAG 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1016354802 6:143206901-143206923 ACTAGTGTTGATGTTTAGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016354798 Original CRISPR CTGGCCTAGCTCATTTAAGT TGG (reversed) Intronic
900518514 1:3094744-3094766 AAGGCCTTGCTCATTTAAGCAGG - Intronic
900871232 1:5305096-5305118 GTGGCCAAGCTCTTTTATGTTGG - Intergenic
900914885 1:5629899-5629921 CTGGCCTCTCTCATTTTACTGGG - Intergenic
906156480 1:43617028-43617050 CTGTCCTGGCTCATTTCATTAGG + Intronic
906156502 1:43617130-43617152 CTGTCCTAGCTCATTTCATTAGG + Intronic
916301226 1:163276646-163276668 CTGACCTAGAACATTTAAATTGG + Intronic
917924832 1:179780827-179780849 CTGGTCTAGCTGATGTAACTAGG - Intronic
919022646 1:192127077-192127099 CTGGCCTAGGTCAGTTAAGGTGG + Intergenic
920323632 1:205144053-205144075 CTGGCATGGCTCATTTGGGTGGG - Exonic
1067228734 10:44392252-44392274 CTGGCCTAGGGGATGTAAGTGGG + Intergenic
1069605593 10:69736986-69737008 CTGGCCTGGCTCAAGTAGGTTGG + Intergenic
1071032043 10:81196496-81196518 CTGGCCTAGAATATTTAAATTGG + Intergenic
1071962090 10:90816962-90816984 CTGGCCTAGAACACTTAAATTGG + Intronic
1072626656 10:97116574-97116596 CTGGTCCAGCTCATTTCAGGAGG + Intronic
1075765995 10:124893505-124893527 CTGGCTTAGTTCATTAAATTGGG + Intergenic
1082696334 11:56369527-56369549 CTAGCCCAGCTAATTTTAGTAGG - Intergenic
1097915673 12:65018306-65018328 CTGGGGCTGCTCATTTAAGTTGG - Intergenic
1099864301 12:88259914-88259936 CTTGCCTAGCTGAATTATGTAGG + Intergenic
1101678348 12:106940184-106940206 CTGGCCTAGAACATTTAAATTGG - Intergenic
1101746321 12:107544358-107544380 CTGGCCTATGTCAGATAAGTGGG + Intronic
1102426777 12:112849977-112849999 CTGTTCTAGATCATTTAAGCTGG - Intronic
1103122616 12:118393562-118393584 CTGACCTAACACATTGAAGTTGG - Intronic
1104267303 12:127245425-127245447 CTGGACTATCTCATTAAAGAAGG + Intergenic
1112556266 13:100471531-100471553 CAGGCCTACCTCATTTTATTAGG - Intronic
1113049508 13:106194005-106194027 CTGGCCTAGCTAAATGAATTTGG - Intergenic
1115701097 14:35953761-35953783 ATAGCATAGATCATTTAAGTGGG - Intergenic
1119908311 14:78325605-78325627 ATGGCCTTTCTCATTCAAGTAGG + Intronic
1125582484 15:40796359-40796381 TGGGGCTAGCTCATTTAAATAGG + Intronic
1126410570 15:48369121-48369143 CTTCACTAGCTCATTTAAGAGGG + Intergenic
1130069710 15:80636158-80636180 CAGCCTTGGCTCATTTAAGTGGG - Intergenic
1133387896 16:5385551-5385573 CTGATCTAGGTCATTTAAGGGGG - Intergenic
1134262934 16:12667455-12667477 CTGGCCTATCTCATTTATTGAGG - Intronic
1138633233 16:58316180-58316202 CTGGCCTAGAACATTTAAATTGG + Intronic
1150379247 17:64707757-64707779 CTGGACCAGCTCAATGAAGTAGG - Intergenic
1151488569 17:74418073-74418095 CTGTCCTAGGTCATTTTGGTCGG - Intergenic
1153488302 18:5624289-5624311 CTGGCCTCGCTCATGTATTTAGG + Intronic
1159323595 18:66887168-66887190 CTGGCCTAGAACATTGAAATTGG - Intergenic
1160591941 18:79950044-79950066 CTGGCCTGCCTTATTTAAATAGG - Intronic
1164403060 19:27915966-27915988 CTGGCCTAGCATAATTAATTGGG + Intergenic
926804116 2:16688815-16688837 CTGGCCAGGCCCTTTTAAGTTGG - Intergenic
927566673 2:24119482-24119504 CTGCCCTAGCTGGTTTGAGTTGG + Intronic
928561718 2:32495342-32495364 GTGGCCTAGTTTATTTAAGAGGG + Intronic
931856458 2:66307014-66307036 CTGTCCTGGCTCATGTAAGCAGG + Intergenic
932929539 2:76017773-76017795 TTGACCTAACTTATTTAAGTAGG + Intergenic
933395663 2:81727850-81727872 CTGGCATTGTTCATTGAAGTTGG + Intergenic
935651187 2:105383503-105383525 CTTGCCTGTCTCATTTAAGTAGG + Intronic
935914143 2:107931100-107931122 CTGGCCTAAATTATTTATGTTGG - Intergenic
940545192 2:155074101-155074123 CTGGCCTAGCTTAATAATGTTGG + Intergenic
940907810 2:159184582-159184604 CTGGCCCAGTTCATGTCAGTTGG - Intronic
941138885 2:161752173-161752195 CTGACCTATCTCACTTGAGTAGG + Intronic
1170254798 20:14328783-14328805 GTGGGCAAGCTCATTAAAGTGGG + Intronic
1170408207 20:16061803-16061825 CTGGCCTGGATCATTTAAAGAGG - Intergenic
1177034880 21:16029661-16029683 CTGGCCTTGCTCACATATGTTGG + Intergenic
1182709792 22:32313771-32313793 CTGGCCAATGTCATGTAAGTGGG + Intergenic
954371755 3:50172632-50172654 CTGTCCTGGCTCATTCAAGGTGG + Intronic
959937741 3:112047159-112047181 CTTGACTGGCTCATGTAAGTGGG + Intronic
964372393 3:156014149-156014171 CTGGCTTATCTCATTTAACATGG - Intergenic
965372008 3:167874715-167874737 CTGGCTGAGAACATTTAAGTTGG + Intergenic
969713611 4:8858180-8858202 CGGGCCTCGCTCATTTGATTTGG - Intronic
971872241 4:32257513-32257535 CTGTTCTGGCTCACTTAAGTTGG - Intergenic
978016063 4:103748384-103748406 CTGACCTAGGACATTTAATTGGG + Intergenic
979605767 4:122637293-122637315 CTGGGCTTGCTCATTTATCTGGG + Intergenic
982500740 4:156151730-156151752 CTGGCCTAGAACCTTTAAATTGG - Intergenic
982842613 4:160210598-160210620 CTGGCCTAGGGCATTTATGGTGG - Intergenic
983789218 4:171774652-171774674 CTGTCTTCACTCATTTAAGTCGG - Intergenic
989319377 5:40117263-40117285 CTGGCCTAGAACATTTAAATTGG - Intergenic
991344720 5:65651627-65651649 CTGGTTTAGCACATTTATGTGGG + Intronic
992402576 5:76425175-76425197 CTATGCTAGCTCAGTTAAGTTGG + Intronic
994885128 5:105550453-105550475 CTGGCATTGCTTATTTAAGTAGG + Intergenic
1009737152 6:67690904-67690926 CTGGCCTAGATCATTTGAATTGG + Intergenic
1015171414 6:130259040-130259062 CTGGCCTAGCCCATACAGGTTGG + Intronic
1016354798 6:143206848-143206870 CTGGCCTAGCTCATTTAAGTTGG - Intronic
1020877754 7:13719535-13719557 GTGGCCTAACTCACCTAAGTTGG - Intergenic
1022847673 7:34227241-34227263 GTGGCCCATCTCAGTTAAGTGGG - Intergenic
1024557485 7:50615898-50615920 CTGGCCTAGTTCTCATAAGTTGG - Intronic
1026402713 7:70031565-70031587 CTGGCATAGCTCAGTGAAGATGG + Intronic
1027932575 7:84556231-84556253 CTGGCCAAACTGATTTAAGAAGG + Intergenic
1028042943 7:86079922-86079944 CTGCTCTAGCTCTTTTAACTGGG + Intergenic
1033435352 7:141328739-141328761 TTGGCCTAGGTCATTTAACCTGG - Intronic
1037510628 8:19578264-19578286 CTGGCCTAGCTCACATAATAGGG - Intronic
1037907803 8:22725637-22725659 CTGGCCTAGGTCTTTCAAGGTGG + Intronic
1041315786 8:56560805-56560827 CTGTCCTGGCTGATTTCAGTTGG + Intergenic
1056238435 9:84619280-84619302 CTGGCTTAGCTCCTTCCAGTTGG + Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1190391392 X:49935232-49935254 CTGGCCTAGATCATTTCAGTTGG + Intronic
1193383915 X:80848329-80848351 TTGGCCTAGAACATTTAAATTGG - Intergenic
1197930655 X:131691284-131691306 CTGGCCTAGGATATTTAAATTGG - Intergenic
1198982799 X:142418734-142418756 CTGGCCTAGAATATTTAAATTGG + Intergenic
1201275785 Y:12297092-12297114 CTGTCCTAGGACATTTAAATTGG - Intergenic