ID: 1016354897

View in Genome Browser
Species Human (GRCh38)
Location 6:143208064-143208086
Sequence TGCTAAGGAATGCACTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016354894_1016354897 -3 Left 1016354894 6:143208044-143208066 CCAGAATGCCATCTAAAGCGTGC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1016354897 6:143208064-143208086 TGCTAAGGAATGCACTGTAGAGG 0: 1
1: 0
2: 1
3: 15
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016354897 Original CRISPR TGCTAAGGAATGCACTGTAG AGG Intronic
900073057 1:789400-789422 TGGTATGGAATGCAATGTAATGG + Intergenic
908479194 1:64520483-64520505 TATTCAGGAATGCACTCTAGGGG - Intronic
913589065 1:120305206-120305228 TGCTAAGGAATGTCCTGGGGAGG + Intergenic
913619120 1:120593163-120593185 TGCTAAGGAATGTCCTGGGGAGG - Intergenic
914571086 1:148917089-148917111 TGCTAAGGAATGTCCTGGGGAGG + Intronic
914601745 1:149213182-149213204 TGCTAAGGAATGTCCTGGGGAGG - Intergenic
915542867 1:156579800-156579822 TGGTCAGGAATGCCCTGGAGTGG + Intronic
921264243 1:213409329-213409351 TGCTAAGGAATGCGAGGAAGGGG + Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923154296 1:231263663-231263685 TGCTAAGGAAGGCAGTATGGTGG - Intronic
923435317 1:233962794-233962816 TGAAAAGGAATGCACTGTAGAGG - Intronic
1064547477 10:16465254-16465276 TGCTAAGGTAGGCACTGTGTTGG + Intronic
1066737876 10:38495259-38495281 TTCTATGGAATGCAATGGAGTGG + Intergenic
1066739348 10:38506251-38506273 TGCAAAGGAATGGAATGTACTGG + Intergenic
1066742165 10:38527652-38527674 TGCTATGGAATGCAATGGAATGG + Intergenic
1066766384 10:38806708-38806730 TGCAATGGAATGGAATGTAGTGG - Intergenic
1066773678 10:38867745-38867767 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1066937553 10:41857680-41857702 TGCAATGGAATGCAGTGGAGTGG + Intergenic
1066937604 10:41858014-41858036 TGCAAAGGAATGCAATGTTATGG + Intergenic
1066945999 10:41911525-41911547 TGCAATGGAATGCAATGGAGAGG + Intergenic
1066971298 10:42314347-42314369 TGGAATGGAATGCACTCTAGTGG - Intergenic
1067266160 10:44747350-44747372 TACTGAGGAATACACTTTAGTGG + Intergenic
1068467063 10:57407951-57407973 TGCAAAGGACTGCTCTGTATGGG - Intergenic
1069058154 10:63866111-63866133 GACTAAGGAATGAACTGAAGAGG + Intergenic
1071137598 10:82469923-82469945 TGCTAAGAAACGCAATGTAGTGG + Intronic
1072748020 10:97955419-97955441 TGCTAAGCAGTGCAGTGTACAGG - Intronic
1075204189 10:120432439-120432461 TGCTTAGGAATGGCCTCTAGAGG + Intergenic
1076790989 10:132776691-132776713 TGCTTGGGACTGCACTGAAGTGG - Intronic
1086794193 11:91080422-91080444 TTCTAAGAAAAACACTGTAGAGG + Intergenic
1091813369 12:3418257-3418279 TGCTAAGGAAAGGGCTGAAGAGG - Intronic
1092839958 12:12530657-12530679 TGCCAAGAAATGCACTGTATAGG - Intronic
1095640122 12:44477658-44477680 TGCTACAGAATGCACTCCAGAGG - Intergenic
1097726360 12:63079756-63079778 TGCTAGGGAATGCATAGTATTGG + Intergenic
1101087238 12:101248874-101248896 TGAAAAGGAATGCACTGCCGGGG + Intergenic
1102651865 12:114448032-114448054 GGCCCAGGAATGCACAGTAGTGG + Intergenic
1106214105 13:27678903-27678925 TGGAAAGGGATGCACTGCAGAGG + Intergenic
1108030416 13:46223553-46223575 TGCTAAGAAATCCACTGTTAAGG + Intronic
1111906105 13:94257910-94257932 TGCTAAGGAAGGAAGTGTAGTGG - Intronic
1113997125 14:16097856-16097878 TGCGATGGAATGGAATGTAGAGG - Intergenic
1117709519 14:58510763-58510785 TGCTAAGTATTTCACTGTACAGG - Intronic
1202873743 14_GL000225v1_random:189534-189556 TGGAAAGGAATGGACTCTAGTGG + Intergenic
1124273779 15:28308106-28308128 TGCTAGGGATTGCACTGAATCGG + Intronic
1130029775 15:80301703-80301725 TGTTCAGGAATGCAGTGTACAGG + Intergenic
1130516551 15:84630312-84630334 TCTTAAGGAATGCAATGCAGCGG - Intergenic
1133840396 16:9402852-9402874 TGCTTATGAATGCAATTTAGAGG + Intergenic
1135923623 16:26673190-26673212 TGCTAAGGAATGTACCCTACAGG + Intergenic
1140399852 16:74662743-74662765 ATGTTAGGAATGCACTGTAGGGG + Intronic
1140718311 16:77747109-77747131 TGCAAAGGAATGCAATGAAGTGG - Intergenic
1143943939 17:10572818-10572840 TTTTTATGAATGCACTGTAGGGG - Intergenic
1144789224 17:17848177-17848199 TGCTGAGGAATGCAGTGGGGAGG + Intronic
1145333029 17:21888852-21888874 TGCAATGGAATGGAGTGTAGTGG + Intergenic
1145333074 17:21889182-21889204 TTGAAAGGAATGGACTGTAGTGG + Intergenic
1145337648 17:21926532-21926554 TGCAAAGGAATGGAATGTATTGG + Intergenic
1145341705 17:21960442-21960464 TGCAATGGAATGGAATGTAGTGG + Intergenic
1145342335 17:21965791-21965813 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1145345639 17:21988656-21988678 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1145696855 17:26795357-26795379 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1145707006 17:26879949-26879971 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1146458526 17:33025605-33025627 TGCTAAGGAATGCAGGGGAGAGG - Intronic
1147726576 17:42569308-42569330 GGCTAGGGAAAGCACTGGAGGGG + Intronic
1150957635 17:69878129-69878151 TGCTATGGAAAACACTGTGGTGG + Intergenic
1151081197 17:71331349-71331371 TGTTAAGAATTTCACTGTAGTGG + Intergenic
1203178803 17_KI270729v1_random:40023-40045 TGGGAAGGAATGGAATGTAGTGG + Intergenic
1203194956 17_KI270729v1_random:223131-223153 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1203198847 17_KI270729v1_random:256945-256967 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1203200052 17_KI270729v1_random:267365-267387 TGCAAAGGAATGGATTGGAGTGG + Intergenic
1203204310 17_KI270730v1_random:22522-22544 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1203208451 17_KI270730v1_random:57698-57720 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1203209647 17_KI270730v1_random:68074-68096 TGCAAAGGAATGGATTGGAGTGG + Intergenic
1203212525 17_KI270730v1_random:92018-92040 TGGAAAGGACTGCAGTGTAGTGG + Intergenic
1154079686 18:11243708-11243730 TGCTGAGGCCTGCACTGGAGAGG + Intergenic
925530459 2:4855152-4855174 TGATAAGGAGTGCTCTGTATTGG - Intergenic
928995483 2:37286176-37286198 CGCCAAGGAATGCAGTGTAAAGG - Exonic
929667786 2:43846733-43846755 TGCTAAGTAAGACACTGGAGAGG - Intronic
932750094 2:74366017-74366039 GGCTAAGGAATGGTCGGTAGGGG + Exonic
934193824 2:89823184-89823206 TGCAATGGAATGGACTCTAGTGG - Intergenic
934194066 2:89825185-89825207 TGGGATGGAATGCAATGTAGTGG - Intergenic
935157615 2:100497207-100497229 TGCTACGGCCTGCACTGAAGAGG + Intergenic
936008383 2:108909545-108909567 TGCCAAGGGAGGCACTGTTGCGG + Intronic
937254571 2:120546154-120546176 TGGTGAGGAATGCACCGGAGAGG + Intergenic
939170582 2:138690424-138690446 TGCAATGGAATGCACTGAGGAGG - Intronic
940440100 2:153705020-153705042 TGCTGAGGTATGCAATGTTGTGG - Intergenic
941060059 2:160836831-160836853 TTCCAAGGAATTCAGTGTAGTGG - Intergenic
942591258 2:177549176-177549198 TGCTATGGGATGCAGTGAAGAGG + Exonic
945898553 2:215512812-215512834 TGGTAAGAAATACACTGTAATGG - Intergenic
946388914 2:219404002-219404024 TGGTAAGAAATGCCCTGTGGAGG + Intergenic
946826444 2:223683363-223683385 TGCTAAGAATTTCACTGTATAGG - Intergenic
946917855 2:224544174-224544196 TGCTAAGTAAGGCATTGCAGTGG - Intronic
947471519 2:230405304-230405326 TGAGAAGGAATGCACTGTTGAGG + Intergenic
1168729070 20:61413-61435 TGGAAAGGAATGGAATGTAGTGG - Intergenic
1171922641 20:31163369-31163391 TGCAAAGGAATGGACTGGAATGG + Intergenic
1171923794 20:31172325-31172347 TGGTATGGAATGCAGTGGAGTGG + Intergenic
1171931172 20:31230503-31230525 TGGAAAGGAATGGACTGTAATGG + Intergenic
1171933019 20:31245443-31245465 TGGAAAGGAATGGAGTGTAGTGG + Intergenic
1176527341 21:7930064-7930086 TGCAATGGAATGCAATGGAGTGG - Intergenic
1176636511 21:9248779-9248801 TGGAAAGGAATGCAGTGGAGTGG + Intergenic
1176754350 21:10714689-10714711 TGGAATGGAATGCACTGTATTGG - Intergenic
1176755083 21:10719915-10719937 TGCAAAGGAATGGAATGTAGTGG - Intergenic
1176755166 21:10720549-10720571 TGCAAAGGAATGGAATGGAGTGG - Intergenic
1176756338 21:10728462-10728484 TGCTATGGAATGGAGTGTAGTGG - Intergenic
1176756884 21:10732072-10732094 TGCAATGGAATGCAATGCAGTGG - Intergenic
1176757027 21:10733185-10733207 TGGTATGGAATGGAGTGTAGTGG - Intergenic
1176757190 21:10734282-10734304 TGGTAAGGAATGGAGTGTAGCGG - Intergenic
1176964677 21:15198664-15198686 TGCAAAAGAATCTACTGTAGTGG + Intergenic
1178987943 21:37324746-37324768 TGATAAGAAGTCCACTGTAGAGG + Intergenic
1180282671 22:10717673-10717695 TTCAAAGGAATGGACTGTAATGG - Intergenic
1183084200 22:35476570-35476592 ACCTATGGAATGCACAGTAGGGG - Intergenic
1203291047 22_KI270735v1_random:39957-39979 TGTAATGGAATGCAATGTAGTGG - Intergenic
1203296568 22_KI270736v1_random:47931-47953 TGGAAAGGAATGTACTGGAGTGG + Intergenic
1203297062 22_KI270736v1_random:50810-50832 TGCAATGGAATGGACTGCAGTGG + Intergenic
1203298634 22_KI270736v1_random:61596-61618 TGGAAAGGAATGGAATGTAGTGG + Intergenic
1203299437 22_KI270736v1_random:66789-66811 TGGAATGGAATGCAGTGTAGTGG + Intergenic
1203300027 22_KI270736v1_random:70645-70667 TGCTATGGAATGGAATGGAGGGG + Intergenic
1203300426 22_KI270736v1_random:73317-73339 TGGAAAGGAATGCAGTGTAGTGG + Intergenic
1203301229 22_KI270736v1_random:78499-78521 TGGAATGGAATGCAGTGTAGTGG + Intergenic
1203301501 22_KI270736v1_random:80349-80371 TGCGATGGAATGCAGTGAAGGGG + Intergenic
1203303498 22_KI270736v1_random:93479-93501 TGCAATGGAATGCAGTGGAGTGG + Intergenic
1203304277 22_KI270736v1_random:98340-98362 TGGAAAGGAATGTAATGTAGTGG + Intergenic
1203305221 22_KI270736v1_random:104439-104461 TGCAATGGAATGCAGTGTAGTGG + Intergenic
1203306743 22_KI270736v1_random:114540-114562 TGAAATGGAATGCAGTGTAGTGG + Intergenic
1203307223 22_KI270736v1_random:117684-117706 TGGAAAGGAATGTAGTGTAGTGG + Intergenic
1203308324 22_KI270736v1_random:124955-124977 TGCAGAGGAATGAAATGTAGTGG + Intergenic
1203310627 22_KI270736v1_random:140231-140253 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1203310638 22_KI270736v1_random:140296-140318 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1203311022 22_KI270736v1_random:142866-142888 TGGAAAGGAATGCAGTGGAGTGG + Intergenic
1203311338 22_KI270736v1_random:144924-144946 TGCTATGGAATGGAGTGCAGTGG + Intergenic
1203311860 22_KI270736v1_random:148278-148300 TGGTAAGGAATGGAATGGAGTGG + Intergenic
1203312087 22_KI270736v1_random:149846-149868 TGGAATGGAATGCAGTGTAGTGG + Intergenic
1203312115 22_KI270736v1_random:150095-150117 TGGAATGGAATGCAATGTAGTGG + Intergenic
1203312739 22_KI270736v1_random:154131-154153 TGGAATGGAATGGACTGTAGTGG + Intergenic
1203313005 22_KI270736v1_random:155941-155963 TGGATAGGAATGCAATGTAGTGG + Intergenic
1203313675 22_KI270736v1_random:163353-163375 TGCAATGGAATGCACTGGAGTGG + Intergenic
1203314458 22_KI270736v1_random:173573-173595 TGGAATGGAATGGACTGTAGCGG + Intergenic
949689313 3:6616933-6616955 AGCCAGGAAATGCACTGTAGAGG - Intergenic
953292321 3:41677629-41677651 TGCTAAACAATGAACTTTAGGGG - Intronic
957640859 3:82851441-82851463 TGCAATGGGATGCACTATAGGGG + Intergenic
959523259 3:107344910-107344932 TACCCAGGAATGCACTGAAGAGG - Intergenic
961587776 3:127948266-127948288 TGCTTAGGATGGCACTGAAGTGG - Intronic
962933334 3:140057487-140057509 TGCTAAGAAATTCAGTTTAGTGG - Intronic
964401913 3:156308412-156308434 TGGTGAGGAATAGACTGTAGGGG + Intronic
969141444 4:5077689-5077711 TGCTATGGATTGCACGGTACTGG - Intronic
969491533 4:7502010-7502032 AGAGAAGGACTGCACTGTAGGGG - Intronic
970304552 4:14718156-14718178 TCATAAGGAATGCAGTGTTGAGG - Intergenic
970923294 4:21420178-21420200 TACTAAGGAATGCATTGCACTGG + Intronic
973403807 4:49654956-49654978 TGCAAAGGAATGCAATGGAATGG + Intergenic
975359709 4:73453930-73453952 TGCTATGGAATTTTCTGTAGTGG + Intronic
975769574 4:77706834-77706856 TGTTAAGAAATGCACTGGTGAGG + Intergenic
980232519 4:130062731-130062753 TGCTAAGGAAAGCACCACAGAGG - Intergenic
980779094 4:137473910-137473932 TGATAAGGAACGCACTCCAGCGG + Intergenic
1202751406 4_GL000008v2_random:7238-7260 TGGAAAGGAATGCAGTGGAGTGG + Intergenic
986933708 5:12857163-12857185 TGCTAAAGAATGCACAGAAGAGG - Intergenic
988045683 5:25949901-25949923 CACTAAGGAATGAACTATAGGGG - Intergenic
988205704 5:28130793-28130815 TGCTAGGAAAAGCACTGCAGAGG + Intergenic
988853837 5:35206405-35206427 TGCTCAGGAATGTATTGTAAAGG + Intronic
989244434 5:39238393-39238415 TCCTAAAGAATTCACTCTAGGGG + Intronic
997179799 5:131816224-131816246 TGATAAGGAATGCGCTGTGATGG + Intronic
1002396732 5:178962711-178962733 TGCTAAGAAATTCAATGAAGAGG - Intronic
1004080518 6:12387791-12387813 TGGTAAAGAGTGCACTGTATAGG + Intergenic
1007348972 6:41254691-41254713 TGCTGAGGAATCTACTCTAGAGG - Intergenic
1007872919 6:45062428-45062450 TTCTAAAGAGTACACTGTAGGGG + Intronic
1011224248 6:85089382-85089404 TGTTAAGGAGTGCAGTGGAGGGG + Intergenic
1011682576 6:89797420-89797442 TGCTCAAAAATGGACTGTAGCGG + Intronic
1011910376 6:92428687-92428709 ACCTAAGGAATTCACTGTGGGGG + Intergenic
1016354897 6:143208064-143208086 TGCTAAGGAATGCACTGTAGAGG + Intronic
1017877195 6:158534892-158534914 AGCTAAGGAAGGCTCCGTAGAGG + Intergenic
1018752119 6:166816158-166816180 TGGTTAGGAAGGCACTGTTGTGG - Intronic
1020069120 7:5213983-5214005 TTCTAAGAAATGCCCTGAAGGGG - Intronic
1021205407 7:17773945-17773967 TGGGATGGAATGCACTGTATTGG - Intergenic
1021471836 7:21012108-21012130 TGCTAATGGATGCACTGGAATGG - Intergenic
1021636025 7:22694387-22694409 TGCTAAGGAAAACAGTGTGGTGG + Intergenic
1023770221 7:43550327-43550349 TGCTGAATAATGCCCTGTAGAGG + Intronic
1027767001 7:82356831-82356853 TTTTAAGGCATGCACTCTAGAGG - Intronic
1027918991 7:84366511-84366533 TTCTAAGCAAACCACTGTAGTGG + Intronic
1030312699 7:108084068-108084090 TGATAAGGCATGCAATGCAGGGG + Intronic
1031233619 7:119143224-119143246 TCTTCAGGAATTCACTGTAGAGG - Intergenic
1033719419 7:144042038-144042060 TGATAAGTAATTCACTGTAATGG + Intergenic
1035042164 7:155936787-155936809 TGCAAAGCAATGCTCTGCAGTGG - Intergenic
1038310477 8:26442429-26442451 TGCTATGGTATGCTCTGTACAGG - Intronic
1040713678 8:50221304-50221326 TGTTAAGGAATGTGCAGTAGAGG + Intronic
1040735760 8:50506416-50506438 TGCTAAGCAATGCAATCTACAGG - Intronic
1044389412 8:91631930-91631952 TGCATGGGAATGCACTGTGGTGG + Intergenic
1049596478 8:143486283-143486305 TGCCATGGAATGCTCTGCAGTGG + Intronic
1051810857 9:21048090-21048112 TGCCAAGGAATACACAGGAGAGG + Intergenic
1051811122 9:21051093-21051115 TGCTAATGAATGTAGTGCAGTGG - Intergenic
1055163963 9:73168258-73168280 TGCTAGGTACTGCTCTGTAGTGG + Intronic
1056874716 9:90317040-90317062 TGTGACGGAATTCACTGTAGGGG - Intergenic
1203721548 Un_GL000216v2:16970-16992 TGGAATGGAATGCAATGTAGTGG - Intergenic
1203722718 Un_GL000216v2:25382-25404 TGCTAGGGAATGCAATGGAATGG - Intergenic
1203724316 Un_GL000216v2:37474-37496 TGCAATGGAATGCACTGGAATGG - Intergenic
1203727015 Un_GL000216v2:58130-58152 TGCAAATGAATGCAATGGAGTGG - Intergenic
1203730504 Un_GL000216v2:85379-85401 TGGAAAGGAATGTACTGTAATGG - Intergenic
1203730712 Un_GL000216v2:86989-87011 TGGAAAGGAATGGACTCTAGTGG - Intergenic
1203386357 Un_KI270438v1:59268-59290 TGCAATGGAATGCAATGTAATGG + Intergenic
1203389096 Un_KI270438v1:81139-81161 TGCAAAGGAATGGAATGGAGTGG + Intergenic
1203389825 Un_KI270438v1:87461-87483 TGCAATGGAATGCAATGGAGAGG + Intergenic
1203391272 Un_KI270438v1:99391-99413 TGCAAAGGAATGAAATGTAATGG + Intergenic
1203391691 Un_KI270438v1:102848-102870 TGGAATGGAATGCACTGAAGTGG + Intergenic
1203392259 Un_KI270438v1:107677-107699 TGGAATGGAATGCACTGAAGTGG + Intergenic
1203344169 Un_KI270442v1:19819-19841 TGCAATGGAATGGAATGTAGTGG + Intergenic
1203347107 Un_KI270442v1:42753-42775 TGGTATGGAATGGAGTGTAGTGG + Intergenic
1203348456 Un_KI270442v1:56670-56692 TGAAATGGAATGCACTGTACTGG + Intergenic
1203719018 Un_KI270742v1:186313-186335 TGGAAAGGAATGCAGTGGAGTGG - Intergenic
1203653264 Un_KI270751v1:150044-150066 TGGAAAGGAATGCAGTGGAGTGG - Intergenic
1203679125 Un_KI270756v1:48632-48654 TGCAAAGGAATGGAATGGAGTGG - Intergenic
1193765417 X:85522880-85522902 TGAAAATGAATTCACTGTAGAGG + Intergenic
1193846085 X:86472598-86472620 TTTTAAGAAATGCAGTGTAGTGG - Intronic
1195966897 X:110437136-110437158 GGCTTAGGAATGCTCTCTAGTGG + Intronic
1198597773 X:138255656-138255678 TGCCAAGTATTACACTGTAGGGG - Intergenic
1201097276 Y:10630905-10630927 TGGTATGGAATGGAATGTAGTGG - Intergenic
1201098129 Y:10649337-10649359 TGGTATGGAATGGAATGTAGTGG - Intergenic
1201099649 Y:10661793-10661815 TGGTATGGAATGCAGTGGAGTGG - Intergenic
1201100558 Y:10668428-10668450 TGGAAAGGAACGCAATGTAGTGG - Intergenic
1201105123 Y:10757629-10757651 TGCAACGGAATGCAGTGGAGTGG - Intergenic
1201107435 Y:10773569-10773591 TGGAAAGGAATGCAGTGGAGTGG - Intergenic
1201107439 Y:10773594-10773616 TGCAAAGGAATGGATTGGAGTGG - Intergenic
1201109156 Y:10786207-10786229 TGGAAAGGAATGCAATGTAGTGG - Intergenic
1201111167 Y:10800564-10800586 TGCAATGGAATGGAATGTAGTGG - Intergenic
1201112794 Y:10812656-10812678 TGCAATGGAATGGAGTGTAGTGG - Intergenic
1201114983 Y:10828595-10828617 TGCAAAGGAATGAAGTGGAGTGG - Intergenic
1201117250 Y:10844167-10844189 TGCAAAGGAGTGGAATGTAGTGG - Intergenic
1201120551 Y:10869494-10869516 TGCAAAGGAATGGAATGGAGTGG - Intergenic
1201124000 Y:10895920-10895942 TGGTAAGGAATGGATTGGAGTGG - Intergenic
1201135938 Y:10990125-10990147 TGGAAAGGAATGGAATGTAGTGG - Intergenic
1201138374 Y:11007924-11007946 TGGAATGGAATGCAATGTAGTGG - Intergenic
1201142464 Y:11040154-11040176 TGCAATGGAATGCAATGTAATGG - Intergenic
1201197859 Y:11511829-11511851 TGGGAAGGAATGCATTGTAGTGG + Intergenic
1201199541 Y:11526889-11526911 TGCAATGGAATGGACTGTAACGG + Intergenic
1201199910 Y:11530216-11530238 TCCAAAGGAATGCACTCTAATGG + Intergenic
1201214691 Y:11712074-11712096 TTCAAAGGAATGGACTGGAGTGG + Intergenic
1201214780 Y:11712914-11712936 TGGAAAGGAATGGACTGGAGTGG + Intergenic
1202606773 Y:26645881-26645903 TGTAAAGGAATGCAGTGGAGTGG + Intergenic
1202607143 Y:26648761-26648783 TGGAAAGGAATGCAATGGAGTGG + Intergenic
1202607515 Y:26651634-26651656 TGGAAAGGAATGCAGTGAAGTGG + Intergenic
1202608357 Y:26658144-26658166 TGGAAAGGAATGCAGTGAAGTGG + Intergenic
1202608722 Y:26661037-26661059 TGGAAAGGAATGCAGTGGAGTGG + Intergenic
1202609088 Y:26663885-26663907 TGGAAAGGAATGCAGTGAAGTGG + Intergenic
1202609469 Y:26666738-26666760 TGGAAAGGAATGCAGTGGAGTGG + Intergenic
1202609973 Y:26670569-26670591 TGGAAAGGAATGCAGTGAAGTGG + Intergenic
1202623632 Y:56835943-56835965 TGCAATGGAATGCAGTGGAGTGG - Intergenic