ID: 1016356371

View in Genome Browser
Species Human (GRCh38)
Location 6:143223127-143223149
Sequence TCTGCTAGACAGAGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016356371 Original CRISPR TCTGCTAGACAGAGGCTGGC TGG (reversed) Intronic
900547874 1:3238593-3238615 TCTGCGAGCCAGAGGCGGGGCGG + Intronic
900999958 1:6143983-6144005 GCTGCTAGGCACAGGCTGCCGGG - Intronic
902785584 1:18730798-18730820 TCTGCTGGGGAGAGGCTTGCTGG - Intronic
907813777 1:57898249-57898271 TCTGCCAGACAGAGGCTGACTGG + Intronic
909839948 1:80307850-80307872 TCTGTTAGAGTAAGGCTGGCTGG - Intergenic
911235749 1:95410527-95410549 TATGGTAGATAAAGGCTGGCTGG + Intergenic
912435022 1:109655884-109655906 TCTGGGAGACTGAGGCTGCCAGG - Intergenic
915614333 1:157025031-157025053 TGTGCTAGACAGAGGTTGTGGGG - Intronic
920517002 1:206592584-206592606 GCTGCCAGAGAGAGCCTGGCAGG + Intronic
921212873 1:212914986-212915008 TCTGCTAGACACAGACATGCAGG + Intergenic
922029939 1:221788150-221788172 TCTGCTTGACAGTCGATGGCAGG - Intergenic
924710103 1:246524297-246524319 TCTGGAACACAGAGGCAGGCTGG + Intergenic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1064309816 10:14202200-14202222 GCTGCAAGACAGTGGCAGGCAGG + Intronic
1065126986 10:22583493-22583515 GGTGCTAGACAGAGCCTGTCAGG + Intronic
1066203561 10:33165014-33165036 TCAGCCAGCCAGAGGCTGTCAGG + Intergenic
1067416118 10:46104536-46104558 TCTTCTAGCCAGAGGCCAGCAGG + Intergenic
1068004804 10:51380555-51380577 TTTGGGAGACTGAGGCTGGCAGG + Intronic
1069169261 10:65204638-65204660 TTTGGGAGACTGAGGCTGGCGGG + Intergenic
1069526947 10:69180601-69180623 TCTGCTGGGCCGAGGCTGGTTGG + Intronic
1069883783 10:71610749-71610771 TTTGCAAGAGAGAGGCTGGGAGG - Intronic
1071486831 10:86107778-86107800 TCTGCTGGTCAGTGGCTGGCTGG - Intronic
1072434542 10:95403255-95403277 TCTGCTACAGAGAGGGAGGCTGG + Intronic
1075897842 10:126013480-126013502 TCTGCTGGACTTAGGCTGGTGGG + Exonic
1076250786 10:128982464-128982486 GCTTCCAGACAGAGGCTGCCAGG + Intergenic
1076316585 10:129546289-129546311 TCCTCAAGACAGCGGCTGGCAGG + Intronic
1076703769 10:132290102-132290124 TCTGCTGGCCATAGGGTGGCCGG - Intronic
1076877064 10:133221129-133221151 TCTGCAGCACAGAGGCTGCCCGG + Intronic
1077121101 11:908912-908934 TCTGCTGGACACATGCTGGCAGG - Intronic
1077613753 11:3660667-3660689 TCTCCTGGTCAGAGGCTGGAAGG + Intronic
1079134403 11:17768255-17768277 TTTTCCAGACAGAGACTGGCAGG + Intronic
1081569254 11:44279376-44279398 TGTGTGAGACAGAGGGTGGCAGG + Intronic
1084085537 11:66853383-66853405 TCTGCAGGACAGAGGCGGGTGGG + Exonic
1084515191 11:69634201-69634223 GGTGCTAGACAGAGGCTGTTTGG - Intergenic
1085583833 11:77681449-77681471 TCTGTAAGAGAGAGGGTGGCAGG - Intronic
1087342581 11:96926773-96926795 TCTGCTAATCAGATGCTGCCAGG - Intergenic
1087981838 11:104623850-104623872 TCTTTTAGACTGAGGCTGGATGG - Intergenic
1088399342 11:109406160-109406182 GATGCTACTCAGAGGCTGGCAGG - Intergenic
1088781536 11:113138934-113138956 TATGCTAGGCAGAGACTGGAGGG - Intronic
1089679138 11:120109807-120109829 CCTGCTGCACAGAGGCTGGCTGG - Intergenic
1090271569 11:125389600-125389622 ACTGCCAGTCAGAGGCTGGTGGG - Intronic
1091364745 11:135008347-135008369 TCTGCTAGCCAGAGCCTAGCAGG + Intergenic
1091878758 12:3959638-3959660 TCTGCCAGACAGTGGGAGGCAGG + Intergenic
1092533503 12:9364809-9364831 TCTGTCAGACTGTGGCTGGCTGG + Intergenic
1096009667 12:48202335-48202357 CCTGCTAGACAGACTGTGGCTGG + Exonic
1098032097 12:66265544-66265566 TCTGACAGAAAGAGGCAGGCTGG - Intergenic
1098431861 12:70428234-70428256 TTTGGGAGACAGAGGCGGGCAGG - Intronic
1100447777 12:94677145-94677167 AAAGCTAGACAGTGGCTGGCCGG - Intergenic
1100861186 12:98809103-98809125 TCTGTTAACCAGAGGCTTGCTGG + Intronic
1101778691 12:107816552-107816574 TCTGCCAGCAGGAGGCTGGCTGG - Intergenic
1102834785 12:116045404-116045426 TCTGCTAGCAAGAGGATGGGAGG - Intronic
1102835079 12:116049071-116049093 TCTACTAGACATATGCTGACAGG + Intronic
1103201919 12:119094732-119094754 TCTGATAGAGAGAGGCTTACGGG - Intronic
1103503949 12:121427728-121427750 TCTGCTAGGGAGGGGCTGCCAGG - Intronic
1104016891 12:124967581-124967603 TCTGGGAGACTGGGGCTGGCAGG - Intronic
1104277692 12:127344691-127344713 TCTGTGAGACAGAGGGCGGCGGG - Intergenic
1105038038 12:132940681-132940703 CCTGCCAGTCTGAGGCTGGCCGG - Intronic
1105836361 13:24215768-24215790 TCTGCTTGGCAGAGGCAGACTGG - Intronic
1106226520 13:27790668-27790690 TCCGCTGGGCAGAGGCAGGCTGG - Intergenic
1109775175 13:67031460-67031482 TTTGGTAGACAGAAGCAGGCGGG + Intronic
1109886187 13:68548311-68548333 GCTGCTTGACAGAGGCTGGAAGG - Intergenic
1112214425 13:97415521-97415543 TCAGCTAAGCAGAGGCTGGTGGG + Intergenic
1113788155 13:113013829-113013851 TCTGCTACAGAGCGGCTGCCAGG - Intronic
1114239028 14:20849030-20849052 TGTGGTAGACAGAGGGCGGCCGG + Intergenic
1115090698 14:29571103-29571125 TCTACTAGAGTGAGGCAGGCTGG + Intergenic
1117584569 14:57187119-57187141 TGTGCTAGACACATGCTGGGTGG + Intergenic
1119736397 14:76985494-76985516 TGTGCCAGACAGAGGCAGGGTGG - Intergenic
1121735600 14:96216005-96216027 TCTGCCAGACACAGGCCTGCAGG + Intronic
1121889080 14:97572447-97572469 TGGGCTAGAGAGAGGCTGGGAGG - Intergenic
1122577349 14:102750745-102750767 TCTCCTGGGGAGAGGCTGGCTGG + Intergenic
1122880073 14:104686832-104686854 TCTGCTAGAAACAGGCAGGCAGG - Intergenic
1124136150 15:27037978-27038000 TCTGCTGGCCAGAGCCTGGCTGG - Intronic
1125610142 15:40964151-40964173 TATGCCAGGCAGAGGGTGGCAGG + Intergenic
1128737686 15:70062529-70062551 CCTGCCAGCCAGAGGCGGGCTGG - Intronic
1130395447 15:83497062-83497084 TCTGCTATACAGGGTCTGCCAGG + Intronic
1132458517 16:37582-37604 TGGGGTAGCCAGAGGCTGGCTGG + Intergenic
1134450266 16:14358974-14358996 TCTGCTGGGCAGAGCCTTGCTGG - Intergenic
1139298428 16:65922986-65923008 TCTGCTAGCCAGAGACTGCTGGG + Intergenic
1140685259 16:77427457-77427479 TGTGCTAGTCAGAGGGAGGCTGG + Intronic
1141260563 16:82449906-82449928 TCTCCTGGACAGAGTCTGGGTGG - Intergenic
1142404785 16:89882050-89882072 TCAGCTAGTGAGAGGCTGACCGG - Intronic
1143168103 17:4909150-4909172 GCTGCTAGCCAGAAGCCGGCAGG - Intergenic
1144301648 17:13926910-13926932 TTTGGTAGCCAGAGGATGGCTGG + Intergenic
1144677152 17:17168911-17168933 CCTGCTAGACAGTGGCTGTGAGG - Intronic
1146289208 17:31596137-31596159 TCTGCTGGACAGAGTCTACCAGG + Intergenic
1149656774 17:58313822-58313844 GCTGCTAGACACAGGCCTGCTGG - Intronic
1150160914 17:62897108-62897130 TCTTCTATACTGAGTCTGGCCGG + Intergenic
1150626796 17:66847178-66847200 TCTGGGAGACAGAGGGTGCCAGG - Intronic
1152162904 17:78680273-78680295 CCTGCAAGACCGAGGCTGACGGG - Exonic
1153708512 18:7772633-7772655 TCATCTATTCAGAGGCTGGCTGG + Intronic
1154980160 18:21497209-21497231 GCTGCAAGACAGAGGCCGGCAGG - Intronic
1157182469 18:45509930-45509952 TCTGTTAGGCAGAGGATGGATGG - Intronic
1158421829 18:57301703-57301725 TCTGCTAGAGAGAGGCAGGGTGG - Intergenic
1163936810 19:20453792-20453814 TCTCCCAGACAGTGGCTGGGAGG + Intergenic
1163974452 19:20836811-20836833 TCTGCCAGACTGTGGCTGGGAGG - Intronic
1165917630 19:39270295-39270317 TCTGCAGGTCAGAGGCTCGCTGG + Intergenic
1166266715 19:41688898-41688920 TCAGCCAGACAGAGGCTTCCAGG - Intronic
1167572599 19:50298521-50298543 TCTGGGAGGCCGAGGCTGGCAGG + Intronic
1167621462 19:50563283-50563305 TCCGCCAGACAGGGGGTGGCAGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926155944 2:10454143-10454165 TCTGCTACACCGAGCCTTGCGGG + Intergenic
931091750 2:58893875-58893897 TCTGATAAAGGGAGGCTGGCTGG - Intergenic
931188310 2:59975156-59975178 TCAGATTGCCAGAGGCTGGCAGG + Intergenic
933652168 2:84858319-84858341 TCTGCTGGCCACAGGGTGGCAGG - Intronic
934613361 2:95756456-95756478 TCTGCTCCTCAGTGGCTGGCAGG + Intergenic
934647536 2:96067964-96067986 TCTGCTCCTCAGTGGCTGGCAGG - Intergenic
934840910 2:97623784-97623806 TCTGCTCCTCAGTGGCTGGCAGG - Intergenic
935106034 2:100044614-100044636 TGGGCTAGACAGATGCTTGCTGG + Intronic
935577512 2:104726094-104726116 TCTGCTACCTAGTGGCTGGCTGG - Intergenic
938083452 2:128382567-128382589 ACTGCTAGACAGAACCTGGAGGG + Intergenic
938190852 2:129279263-129279285 GCTGCAACACAGGGGCTGGCAGG - Intergenic
944474873 2:200093188-200093210 TCTGGAAGACACAGACTGGCAGG - Intergenic
946737759 2:222771749-222771771 TCTGGGAGGCAGAGGCGGGCTGG - Intergenic
947795000 2:232889079-232889101 GCTGCCAGGCAGAGGCGGGCAGG - Intronic
948863988 2:240766250-240766272 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
1168765376 20:378666-378688 TCCTCTAGGCAGAGGCTGGATGG - Intronic
1169374981 20:5059250-5059272 TCTGAATGACAGAGGCTGGGAGG - Intergenic
1172098637 20:32472962-32472984 CCTGCTGCCCAGAGGCTGGCTGG - Intronic
1173671246 20:44800565-44800587 TCAGCTAGAGAGAAACTGGCAGG + Intronic
1174654480 20:52159035-52159057 TCTGCTGGCCATGGGCTGGCTGG - Intronic
1175414404 20:58792416-58792438 TCTGCCAGCCAGAGCCTGGATGG + Intergenic
1175656356 20:60774482-60774504 TCAGCAAGACAGAGCCTGGAAGG - Intergenic
1175729021 20:61340351-61340373 TGTGCTGGACAGCGGCAGGCTGG - Intronic
1175999403 20:62825252-62825274 TCTTCCAGACAGGGCCTGGCTGG + Intronic
1180720944 22:17907974-17907996 TCTGCTGGACAGAGGCTGGGAGG + Intronic
1181443739 22:22952557-22952579 TCTGCCAGCAGGAGGCTGGCTGG - Intergenic
1181462443 22:23093805-23093827 TCTGGCTGTCAGAGGCTGGCAGG + Intronic
1182548496 22:31089081-31089103 ACTGCTAAATAGAGGCTGGATGG - Intronic
1184789799 22:46693063-46693085 TCTGCTGGACAGAGACTGTGTGG + Intronic
949399650 3:3652496-3652518 TCTCCTAACCAGAGGCTTGCAGG - Intergenic
950399057 3:12756676-12756698 CCAGCTAGACAGAGCCAGGCGGG + Intronic
952010992 3:28901245-28901267 TCTGCCAGTAAGTGGCTGGCTGG + Intergenic
952701103 3:36328599-36328621 TTTTCTGGACAGAGGCTGGTGGG - Intergenic
953842499 3:46400455-46400477 GCTGATAGTCAGAGGCTGGAAGG + Intergenic
955613894 3:60785051-60785073 TCTGGTGGACAGGGGCTGGTAGG - Intronic
957024044 3:75159456-75159478 TCTGCCAGGCTGAGGCGGGCAGG - Intergenic
957822914 3:85401311-85401333 TCTGGCAGACAGAGGCTGAGAGG - Intronic
959382437 3:105657497-105657519 TCTGATAGACAAAGCCTGGAAGG - Exonic
959814329 3:110657913-110657935 TTTGGAAGACAGAGCCTGGCTGG - Intergenic
961422198 3:126815328-126815350 TCTGGCATACAGAGGATGGCTGG - Intronic
961449846 3:126997767-126997789 TCTGCTTCCCAGTGGCTGGCAGG + Intronic
962085866 3:132190889-132190911 ACTGCCAGACAGATCCTGGCTGG + Intronic
964502474 3:157363657-157363679 TCTGAAAGAGAGATGCTGGCTGG + Exonic
967880922 3:194300643-194300665 TCTGCTTGACTGAGCCGGGCTGG - Intergenic
968693737 4:2009873-2009895 TCTGGGAGGCAGAGGCGGGCGGG - Exonic
970407544 4:15778341-15778363 GCAGCAAGAGAGAGGCTGGCTGG - Exonic
970492801 4:16592101-16592123 TCAACAAGAAAGAGGCTGGCAGG + Intronic
973961746 4:56117466-56117488 TCTGATTGCCAGAGGCTGGAAGG + Intergenic
974640717 4:64626270-64626292 TCTTCAAGACAGAGGATGGAGGG + Intergenic
975468367 4:74735257-74735279 TGTGATAGACAGAGGCCGGATGG + Intergenic
976326142 4:83773838-83773860 TCTGCTGGACAGTGGCTGTCAGG - Intergenic
978705733 4:111708243-111708265 TCTGGGAGGCTGAGGCTGGCAGG - Intergenic
979161776 4:117470659-117470681 TCTCCTAGACAAATGCTGCCAGG + Intergenic
988485655 5:31666221-31666243 GCTCCAAGACTGAGGCTGGCTGG - Intronic
990996181 5:61734361-61734383 TCTGCTAGAGAAGGGCTGGAAGG - Intronic
992405133 5:76449707-76449729 TCTGCTGCACAAATGCTGGCAGG + Intronic
992444323 5:76820093-76820115 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
995490775 5:112689628-112689650 TCTCCTACAGAGAGGCTGGAGGG - Intergenic
997962768 5:138335207-138335229 TCTGCCCTGCAGAGGCTGGCTGG - Intronic
998132010 5:139656000-139656022 TCTGCCAGACAGAGGAGGGCGGG - Intronic
1001550891 5:172601699-172601721 TCTGGGAGACCGAGGCGGGCGGG - Intergenic
1002437602 5:179241343-179241365 TGTGCCTCACAGAGGCTGGCTGG - Intronic
1006875505 6:37291945-37291967 TCTGCTTAACTTAGGCTGGCTGG - Intronic
1009435302 6:63610742-63610764 TTTGGGAGGCAGAGGCTGGCGGG + Intergenic
1010332103 6:74635310-74635332 TGTTCTAGGCAGAGGCAGGCAGG - Intergenic
1013127932 6:107203310-107203332 TCTGATAGGGAGAGGCTGACAGG - Intronic
1013839057 6:114368343-114368365 TCTCCTAGAAAGAGGAAGGCCGG + Intergenic
1015161706 6:130159447-130159469 TCTGCCACACAGAGGCGGGTGGG + Intronic
1016356371 6:143223127-143223149 TCTGCTAGACAGAGGCTGGCTGG - Intronic
1019962543 7:4472994-4473016 TCTGCTCGACGGAGACTGGATGG + Intergenic
1020028719 7:4918123-4918145 TCCTGTAGTCAGAGGCTGGCTGG - Intronic
1021909357 7:25368772-25368794 TCTGCTACACAGAGGATGTAAGG - Intergenic
1023357825 7:39385450-39385472 TATGCTAGTCAGAGGCTTGGAGG + Intronic
1023568944 7:41552868-41552890 TCTGCAAGGCAGCAGCTGGCAGG - Intergenic
1024453790 7:49579995-49580017 TCTCCTTGCCTGAGGCTGGCCGG - Intergenic
1026675758 7:72426675-72426697 ACTGATAGACAGAGCCAGGCAGG + Intronic
1032588045 7:133166109-133166131 TCTGCTAGATAGAGGTGGACAGG + Intergenic
1032927509 7:136624523-136624545 TTTGCGAGGCAGAGGCAGGCAGG + Intergenic
1033828769 7:145226620-145226642 TCTTATAGTCAGAGGCTTGCAGG - Intergenic
1034056913 7:148044986-148045008 TAAGCTAGACACAGGGTGGCTGG - Intronic
1036422540 8:8611776-8611798 TCAGCCAGACAGAGGTAGGCTGG - Intergenic
1036440279 8:8775790-8775812 TCTGCTAGAAAGAGGCTTATTGG - Intergenic
1036620673 8:10422985-10423007 TGTGCTGGACAGAGGGAGGCAGG - Intronic
1037837795 8:22224433-22224455 TCTGGCGGACAGAGGTTGGCCGG - Intronic
1048473190 8:134721340-134721362 GAGGCTAGGCAGAGGCTGGCAGG - Intergenic
1048918042 8:139203029-139203051 TGTGCTAGACACAGACTGGAAGG - Intergenic
1049259168 8:141629581-141629603 ACTGCCACCCAGAGGCTGGCTGG - Intergenic
1049769742 8:144374360-144374382 TCTGCTAAACAGAGTCGGCCGGG - Intronic
1049945821 9:594330-594352 CATGATTGACAGAGGCTGGCTGG + Intronic
1053056101 9:34993912-34993934 TCTGCTGGCCAGAAGCAGGCAGG - Intronic
1053299464 9:36938726-36938748 TGAGCTTGACAGAGGGTGGCAGG - Intronic
1057714997 9:97486080-97486102 ACTGCTGGACTGGGGCTGGCTGG - Intronic
1059556860 9:115290018-115290040 TCTCCTTGACTGAGGCTTGCTGG - Intronic
1060252476 9:121997385-121997407 GGGGCTGGACAGAGGCTGGCTGG - Intronic
1060984854 9:127814009-127814031 ACTGCGGGACAGAGGGTGGCTGG + Exonic
1061018999 9:128001849-128001871 GATGCTAATCAGAGGCTGGCTGG - Intergenic
1062021211 9:134320226-134320248 TCTGCTGGACGGAGGGTGGGGGG - Intronic
1062217411 9:135396769-135396791 TCTGCAGGACTGAGGCTGGGAGG + Intergenic
1185566568 X:1099601-1099623 TCAGCTGGACAGAAGGTGGCTGG + Intergenic
1186618197 X:11211999-11212021 TCTGCTAAATTGAGGTTGGCAGG - Intronic
1190974797 X:55388912-55388934 TCTGCTTGACTGAGATTGGCTGG + Intergenic
1193073113 X:77327606-77327628 TCAGCTAGCCAGTGGCTAGCTGG + Intergenic
1197257031 X:124274584-124274606 TCTGCTAGACTGAAGCAGGCAGG - Intronic
1198106343 X:133465272-133465294 ACTGCTAGAGAGAGGTTGGAGGG - Intergenic
1201176833 Y:11314863-11314885 ACTGGCAGAGAGAGGCTGGCGGG - Intergenic