ID: 1016362649

View in Genome Browser
Species Human (GRCh38)
Location 6:143285084-143285106
Sequence GGGGGGATTAAGTACAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016362649_1016362653 -4 Left 1016362649 6:143285084-143285106 CCTCAATTGTACTTAATCCCCCC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1016362653 6:143285103-143285125 CCCCAAATCCTAGAGCTCTTTGG 0: 1
1: 0
2: 3
3: 14
4: 168
1016362649_1016362655 -3 Left 1016362649 6:143285084-143285106 CCTCAATTGTACTTAATCCCCCC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1016362655 6:143285104-143285126 CCCAAATCCTAGAGCTCTTTGGG 0: 1
1: 1
2: 4
3: 12
4: 139
1016362649_1016362657 0 Left 1016362649 6:143285084-143285106 CCTCAATTGTACTTAATCCCCCC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1016362657 6:143285107-143285129 AAATCCTAGAGCTCTTTGGGAGG 0: 1
1: 0
2: 2
3: 22
4: 249
1016362649_1016362659 14 Left 1016362649 6:143285084-143285106 CCTCAATTGTACTTAATCCCCCC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1016362659 6:143285121-143285143 TTTGGGAGGCCCTATCTCCATGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016362649 Original CRISPR GGGGGGATTAAGTACAATTG AGG (reversed) Intronic
905284002 1:36867689-36867711 GGGAGGTTTCAGTAGAATTGGGG + Intronic
905402614 1:37714637-37714659 GGGGTGATTAAGTTAAAATGAGG + Intronic
907957536 1:59244465-59244487 GGGGTGATTAAGTAAAAATGAGG - Intergenic
910220966 1:84889182-84889204 GAGGGGATTTAGTACCATTGAGG - Intronic
913598014 1:120396194-120396216 GGGGGGAATAAGGACAAGTTGGG + Intergenic
914089315 1:144483126-144483148 GGGGGGAATAAGGACAAGTTGGG - Intergenic
914309296 1:146451089-146451111 GGGGGGAATAAGGACAAATTGGG + Intergenic
914592815 1:149122048-149122070 GGGGGGAATAAGGACAAGTTGGG - Intergenic
918741824 1:188141716-188141738 GGGGAGCTTTAGTACAACTGAGG + Intergenic
919717408 1:200793246-200793268 GTGAGGATTAAATACAATAGTGG + Intronic
923552797 1:234977621-234977643 GAGGTGATTAAGTACAAATGAGG - Intergenic
1066223150 10:33355715-33355737 GAAGGGAATAAGTACAAATGTGG - Intergenic
1068128944 10:52873577-52873599 GGAGTGATTAAGTAAAATTATGG - Intergenic
1068586868 10:58809785-58809807 GTGGGGATTGAATAAAATTGTGG - Intronic
1069295543 10:66839565-66839587 GGGGACATTAAGTACTATTTTGG - Intronic
1071096619 10:81982761-81982783 GAGGTGATTAAGTAAAAATGAGG - Intronic
1080018097 11:27528716-27528738 GGGGGAAGTAACTACAATTTAGG - Intergenic
1081634491 11:44711827-44711849 GGGAGGATGAAGTAGAAATGGGG + Intergenic
1083599687 11:63939159-63939181 GGGGGGTTTAAGAACAAAGGGGG - Intronic
1091624453 12:2111503-2111525 GGGGGGATTAAGGGCAATGCAGG + Intronic
1092983252 12:13819068-13819090 GGGGTGATTAAGTTAAAGTGAGG + Intronic
1094279026 12:28714287-28714309 GGAGGGAATGAGTGCAATTGGGG - Intergenic
1096614091 12:52821964-52821986 GGGTGGATTCAGCACAAATGTGG - Exonic
1099948338 12:89271313-89271335 GGGGTGATTAAGTTAAAATGAGG + Intergenic
1104479471 12:129095284-129095306 GGGGTGCTTAAGTAAAAATGAGG + Intronic
1109298825 13:60568947-60568969 GGGGGGAAAAAAAACAATTGCGG - Intronic
1112010451 13:95289605-95289627 GAGGGGAGTAAGTCCTATTGTGG + Intronic
1113334825 13:109367700-109367722 GAGGGGATCAAGTACAGATGAGG + Intergenic
1120112824 14:80578018-80578040 CAGGGAATTAAGTACGATTGAGG - Intronic
1121716138 14:96077407-96077429 GGGGTGATTAAGTTAAAATGAGG + Intronic
1123582897 15:21731702-21731724 GGGGGCACTCAGAACAATTGGGG - Intergenic
1123619547 15:22174298-22174320 GGGGGCACTCAGAACAATTGGGG - Intergenic
1127276900 15:57454119-57454141 AGAGGGAATAAGTATAATTGAGG + Intronic
1127610262 15:60629811-60629833 GGGGGGATTAGGAATAACTGAGG + Intronic
1138440089 16:57029229-57029251 AGGGTGATTAAGAACAATGGTGG - Intronic
1139007418 16:62590117-62590139 GTGGGGATTAAAGACAAGTGGGG + Intergenic
1140084147 16:71778763-71778785 GGGGGGAAAAAGTACAATGGGGG + Intronic
1140350577 16:74258345-74258367 GAGGTGATTAAGTAAAAATGAGG + Intergenic
1150717634 17:67585421-67585443 GAGGGGATTAAGTTAAAATGAGG + Intronic
1151188994 17:72384095-72384117 AGGAGAATTAAGTAGAATTGAGG + Intergenic
1155234505 18:23805871-23805893 GGGGAGAGTAGGTACTATTGTGG - Intronic
1158129163 18:54133625-54133647 GAGGTGATTAAGTTCAAATGAGG + Intergenic
1163839250 19:19595779-19595801 TGGGGGATTAAGTATACTTGGGG + Intronic
1166659210 19:44634868-44634890 GTGAGGATTAAGTAAAATGGTGG + Intronic
1168336073 19:55598509-55598531 GCGAGAATTAAGTAAAATTGTGG + Intronic
927681890 2:25145175-25145197 GGGGAGAGTCAGTACAAGTGTGG - Intronic
928503303 2:31921127-31921149 GAGGCGATTAAGTTCAAATGAGG + Intronic
930564480 2:53002299-53002321 GGGAGGATTAAGGACAACTATGG - Intergenic
931880858 2:66569139-66569161 GGGGGAAGTAAGTACAAATGGGG + Exonic
932475040 2:72000213-72000235 GGGGGTATGAACTACAATAGTGG - Intergenic
933300516 2:80535700-80535722 TGGGGGCTTAAGTACACTGGGGG - Intronic
935152559 2:100450726-100450748 AGGGGGCTTAAGGACAAGTGGGG - Intergenic
935502761 2:103861234-103861256 GGAGGGAAGAAGTAGAATTGGGG + Intergenic
936794313 2:116187878-116187900 GGCGAGATTAAGTCCCATTGCGG + Intergenic
937446158 2:121960089-121960111 GGGGGGGTGAAATAGAATTGTGG + Intergenic
939052628 2:137326395-137326417 GGGGGGCTTAAGAACTTTTGTGG - Intronic
939658615 2:144859180-144859202 AAGGGGAGTAAGTACAAATGTGG + Intergenic
939873743 2:147553533-147553555 GGGGAGAGTAAGTACAAATATGG + Intergenic
940252811 2:151698444-151698466 GGGGGGATTAAAAAAAATTCTGG + Intronic
941729368 2:168899008-168899030 GGGGTGATTAAGTTAAAATGAGG + Intronic
942438555 2:176006754-176006776 GAGGGGATTTATTACAATTGAGG + Intergenic
943803680 2:192094215-192094237 GAGAGGGTTGAGTACAATTGTGG + Intronic
945327727 2:208502008-208502030 GGGAGAATTTAGTACATTTGGGG + Intronic
1172479574 20:35263197-35263219 GGGGGGTTTAAGTAGGAGTGGGG - Intronic
1172909795 20:38399509-38399531 GGGGTGATTAAGTTAAAATGAGG + Intergenic
1173292226 20:41725023-41725045 GAGGTGATTAAGTAAAAATGAGG - Intergenic
1175057367 20:56210484-56210506 GAGGTGATTAAGTAAAAATGAGG + Intergenic
1178029542 21:28508172-28508194 GTGGGGATTAAGCACAAATAAGG - Intergenic
1178698144 21:34811652-34811674 GGGGGGAATAAAAACAACTGGGG - Intronic
1179193498 21:39143352-39143374 AGGGTGATTAAGTTCAAATGAGG - Intergenic
1184520493 22:44991181-44991203 AAGGGGATTAAGTTCAAATGAGG + Intronic
950166101 3:10800484-10800506 GGGGGGATTAACAAAAATTGGGG + Intergenic
952325630 3:32318156-32318178 GCGGGGATTAAGTATAACTTTGG + Intronic
953403442 3:42647336-42647358 AAGGTGATTAAGTACACTTGGGG - Exonic
953953552 3:47212400-47212422 TGGGGGATAGAGTACAACTGTGG + Intergenic
955934412 3:64089042-64089064 GGGTAGATTATGTACAATTCAGG - Intergenic
956695961 3:71919681-71919703 GAGGGGACAAAGTCCAATTGTGG - Intergenic
959809768 3:110603247-110603269 GGAGGGATTTGGAACAATTGAGG - Intergenic
962058189 3:131896724-131896746 GGAGGTATCAAGTACAATGGAGG - Intronic
968253166 3:197241692-197241714 GGAGGGATGAAGTTAAATTGTGG + Intronic
968437822 4:603318-603340 GAGGTGATTAAGTAGAAATGAGG - Intergenic
972719809 4:41684818-41684840 GGGGAGATTATGTCCAATGGTGG - Intronic
976123036 4:81803876-81803898 GGGTGAATTAAGTAAAATTTTGG - Intronic
976317468 4:83673809-83673831 GGAGGGATTAAATGCAACTGGGG - Intergenic
988130924 5:27105356-27105378 GGGGCGATTAAGTTAAAATGAGG + Intronic
990663181 5:58041939-58041961 GGTGGCATGCAGTACAATTGTGG - Intergenic
991537404 5:67686045-67686067 GGGGTGATTAAGTTAAAGTGTGG - Intergenic
995014430 5:107293877-107293899 GGGGTGATAAAGTAAAAGTGAGG - Intergenic
1012013128 6:93818141-93818163 GGGTGGTATAAGTACAATTGTGG - Intergenic
1014378242 6:120704714-120704736 GAGGGAATTAACTACAAATGTGG - Intergenic
1016362649 6:143285084-143285106 GGGGGGATTAAGTACAATTGAGG - Intronic
1016368170 6:143341461-143341483 GAGGGGATTAAGTTAAAATGAGG + Intergenic
1019480713 7:1265420-1265442 GGGGAGATTGTGTAGAATTGGGG + Intergenic
1019866291 7:3713291-3713313 GTTGTGATAAAGTACAATTGGGG + Intronic
1021611750 7:22464570-22464592 GAGGTGATTAAGTTAAATTGAGG + Intronic
1022923950 7:35042037-35042059 GGGGGAACTAAGTACCCTTGGGG - Intergenic
1029822265 7:103157810-103157832 GGGGGAACTAAGTACCCTTGGGG - Intergenic
1031166782 7:118238936-118238958 GGGGTGATTAAGTTAAAGTGAGG + Intronic
1033141157 7:138827804-138827826 GGGAGGATTAACTTCAATTTTGG + Intronic
1036766316 8:11551452-11551474 GGGGTGATTAAGTTAAAATGAGG - Intronic
1037688897 8:21166437-21166459 GGACAGATTAATTACAATTGGGG - Intergenic
1043780994 8:84334987-84335009 GGAAGGATAAAGTACAATAGAGG - Intronic
1044987217 8:97766156-97766178 GAAGAGATTAATTACAATTGTGG - Intergenic
1046090309 8:109495794-109495816 GCTGGTATTAAGTACAATTTAGG + Intronic
1047110898 8:121788081-121788103 GTGGGGAATAAGGACAAATGTGG - Intergenic
1047883445 8:129221249-129221271 TGGGAGATTAACTACAACTGAGG - Intergenic
1048245462 8:132792478-132792500 GGGGGGAGTAAGTATAGGTGAGG - Intronic
1051528061 9:18069719-18069741 GGGTGGATTGAGTAGAAGTGAGG + Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1185843427 X:3414824-3414846 GCGGGGTTGAAGTAGAATTGAGG + Intergenic
1196961693 X:121010365-121010387 GGTGGGGTTCAGTACCATTGGGG - Intergenic
1196985157 X:121261200-121261222 GGGGAGACTAAGTAGCATTGTGG + Intergenic
1197795144 X:130290284-130290306 TGGGGGAGTATGTACAATTATGG + Intergenic
1198659858 X:138956383-138956405 GGGGTGATTATTTATAATTGTGG + Intronic
1199012545 X:142775020-142775042 GGGATGTTTCAGTACAATTGCGG + Intergenic