ID: 1016362855

View in Genome Browser
Species Human (GRCh38)
Location 6:143286789-143286811
Sequence CAGGCTGCTGGCTGTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016362852_1016362855 -9 Left 1016362852 6:143286775-143286797 CCTCAGGGGCTGACCAGGCTGCT 0: 1
1: 0
2: 2
3: 35
4: 310
Right 1016362855 6:143286789-143286811 CAGGCTGCTGGCTGTTTTGCTGG 0: 1
1: 0
2: 1
3: 20
4: 228
1016362847_1016362855 28 Left 1016362847 6:143286738-143286760 CCTGTGCAATACTGAGTAAGGTT 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1016362855 6:143286789-143286811 CAGGCTGCTGGCTGTTTTGCTGG 0: 1
1: 0
2: 1
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016362855 Original CRISPR CAGGCTGCTGGCTGTTTTGC TGG Intronic
900476363 1:2878204-2878226 CTGGCTGCTGGCTGTTGTGGGGG + Intergenic
901002367 1:6155102-6155124 CAGGAAGCTGGGTGTTTTGGGGG - Intronic
901002379 1:6155142-6155164 CAGGAAGCTGGGTGTTTTGGGGG - Intronic
902075631 1:13782606-13782628 CAGGCTCCGTGATGTTTTGCTGG - Exonic
907526808 1:55058496-55058518 CAGGTTGGCAGCTGTTTTGCAGG + Exonic
908090201 1:60677729-60677751 CAAGCTGCTGGCTGCTCTTCTGG + Intergenic
908510932 1:64849625-64849647 CAGGCTCCTGTCTATTTTGAGGG - Intronic
911592381 1:99763055-99763077 GAAGCTGCTGAGTGTTTTGCGGG - Intronic
914804368 1:150981895-150981917 CAGGCTGCAGGCTGATTTCAAGG - Intergenic
917194043 1:172447745-172447767 CAGAATGCTGGCAGTTTTGCCGG - Intronic
919745378 1:201005389-201005411 CTGGGTGCTGGCTGTGGTGCGGG + Exonic
921284059 1:213593319-213593341 CTGGCTGCTTGCTGTGTTGAGGG + Intergenic
921485010 1:215704570-215704592 CAGGCTGCAGGAGATTTTGCTGG - Intronic
921594136 1:217036870-217036892 CACGCTGCTGACTGATTGGCTGG - Intronic
921945706 1:220884630-220884652 CTGGCTGTGGGCTGTGTTGCAGG - Exonic
921998166 1:221444471-221444493 CAGCATCCTGGCTGTTTTCCAGG + Intergenic
922572168 1:226640576-226640598 CAGGCTGTCGGCTGTTCTGACGG + Intronic
922695215 1:227728080-227728102 CAGGCTGCTGTCTGTTCAGAAGG - Intergenic
922868865 1:228883973-228883995 CAGCCTTCAGGCTGTTTTTCTGG - Intergenic
1063102823 10:2965307-2965329 CAGCCTGCTGGCTGCCCTGCAGG - Intergenic
1067799837 10:49351338-49351360 CAGGCTTCAGGCAGTGTTGCGGG + Intergenic
1068534550 10:58227114-58227136 TATGCTGCTGACTGTTTTGATGG - Exonic
1069090598 10:64195515-64195537 CAGGCTGCTGACTCCTTTGCAGG + Intergenic
1069514410 10:69066129-69066151 CAGACTGGAGTCTGTTTTGCTGG + Intergenic
1069616985 10:69812601-69812623 CAGGCTGTGTGCTGTCTTGCAGG + Intronic
1069684509 10:70309091-70309113 CACGCTGCTGGCTGTGCCGCTGG - Intronic
1071259848 10:83909763-83909785 CAGGCTGATGGTTCTTTTGAGGG + Intergenic
1071528991 10:86374883-86374905 CTGTCTGCTGGCTGCCTTGCTGG - Intergenic
1072734032 10:97867190-97867212 CAGGCTGCTGGCACCTTTGAAGG - Exonic
1073154139 10:101333298-101333320 TAGGCTGCTGGTTTATTTGCTGG + Intergenic
1074062751 10:109982403-109982425 CATGCTTCAGGCTGTTTTCCTGG - Intergenic
1074275063 10:111993259-111993281 GAGGCTGCTGGCTGTTTAGCTGG - Intergenic
1075971653 10:126659403-126659425 CTGGCTGCTGGCTACTCTGCTGG + Intronic
1076765701 10:132631724-132631746 CAGGGTGCTGCTTGTTTGGCTGG + Intronic
1077218917 11:1406702-1406724 CCGCCTGCTGGCTGTGCTGCTGG + Intronic
1078085147 11:8229461-8229483 CAGGCTGCTGGATGGTTGCCGGG - Intronic
1078803602 11:14672618-14672640 CAGGCTGCTGGGTCTTTCACGGG + Intronic
1079810445 11:24992441-24992463 TTGGCTGCTGGCTGTTTTAATGG + Intronic
1080052290 11:27869909-27869931 CAGCCTGCTTGCTGGCTTGCTGG + Intergenic
1081869243 11:46375839-46375861 CCGGCTGCTGGCTGTCGGGCAGG - Exonic
1083062781 11:59891880-59891902 CAGACTGCAGGCTGCTGTGCTGG + Intergenic
1083710663 11:64546386-64546408 CAGGCTGGAGGCCGGTTTGCAGG + Intergenic
1083996007 11:66272789-66272811 CAGGCGGTTGGCTGCTATGCTGG + Intronic
1084478641 11:69403652-69403674 CAGGCTGGTGGCTCCCTTGCAGG + Intergenic
1084873025 11:72110354-72110376 CAGGCTGGTGCATGTTCTGCAGG + Exonic
1086242426 11:84711569-84711591 GAGCCTGCTGGCTTTTGTGCTGG - Intronic
1088842864 11:113641420-113641442 CAAGCTGCATGCTCTTTTGCTGG - Intergenic
1089017003 11:115173478-115173500 CATGCTGCCGGCTGGGTTGCTGG - Exonic
1091010720 11:131998124-131998146 CAGGCTGCTGCCTGGTTTTACGG + Intronic
1091217202 11:133909450-133909472 CAGGTTGCTGGTTGTCTTGGCGG - Intronic
1092139403 12:6172355-6172377 CAAGCTGCAGGCTGCCTTGCAGG - Intergenic
1092513588 12:9184505-9184527 CAGGTTGCTGGCCTTTGTGCAGG - Intronic
1096980297 12:55724772-55724794 GTGGGTGCTAGCTGTTTTGCAGG - Intergenic
1097049544 12:56213688-56213710 CAAGCAGCTGACTGTTTTACAGG + Intronic
1097521156 12:60672562-60672584 AAGGCAGCTGGCTGTGTTGTGGG + Intergenic
1098197992 12:68022495-68022517 CAGCCAGTTGGCTGTTTTGCTGG - Intergenic
1102219850 12:111187215-111187237 CAGGCTGCTGGGTGATATGGAGG - Intronic
1103715500 12:122943048-122943070 CGGGCTGCGGGCTTTTTTGTGGG + Intronic
1104469265 12:129016353-129016375 CAGGCTCCTCCATGTTTTGCAGG - Intergenic
1104534453 12:129605883-129605905 CAGGTTCCTGGCTGTTTTCTTGG - Intronic
1105602792 13:21902044-21902066 CAATCTGCTGGCTGCTTTGCTGG + Intergenic
1106435700 13:29721426-29721448 CAGGGTCCTGCCTGTTTTGCTGG + Intergenic
1106486715 13:30179174-30179196 GAGGCTTCTGGTTATTTTGCAGG + Intergenic
1107295251 13:38900891-38900913 CAGGCCCCTGGCTGTTTCGGGGG + Intergenic
1110144067 13:72168105-72168127 CTGGCTGCAGTCTGTTTTTCTGG - Intergenic
1112184619 13:97115681-97115703 CAGGGCTTTGGCTGTTTTGCTGG + Intergenic
1114393872 14:22339048-22339070 CTGGCTTCTGGGTGTTTTGTTGG - Intergenic
1116073099 14:40074218-40074240 CAGGGTCATGGCTGTTCTGCTGG - Intergenic
1116817579 14:49598497-49598519 CGGGCTGCTGGTGGTTTTGGTGG - Intronic
1117192290 14:53304968-53304990 CATGCTGCTGGCTGTGTTGATGG - Intergenic
1121251819 14:92505372-92505394 CTGGCTGATGGCTGTTGTTCTGG - Intergenic
1123846471 15:24308171-24308193 GAAGCTGCTGGCTCTTATGCAGG + Intergenic
1125281710 15:38048549-38048571 GAGGCTGTTGGCTGTTTTGTGGG - Intergenic
1125957238 15:43799005-43799027 CCTGCTGCAGGCTGTGTTGCTGG - Exonic
1126431567 15:48590871-48590893 AAGTCTGTTGGCTGTTATGCTGG - Intronic
1128100700 15:64997334-64997356 GAGCCTGCTGGCTTTTTGGCTGG - Intergenic
1128731790 15:70026298-70026320 CAGGATGCTGGCTGCTGTGTAGG + Intergenic
1129301746 15:74629486-74629508 CAGGCTACTAGGTGTCTTGCTGG - Intronic
1129458064 15:75686313-75686335 CAGGCCTGTGGCTGGTTTGCAGG + Intronic
1130273754 15:82465769-82465791 CAGGCCTGTGGCTGGTTTGCTGG - Intergenic
1130466102 15:84193140-84193162 CAGGCCTGTGGCTGGTTTGCTGG - Intergenic
1130498161 15:84480396-84480418 CAGGCCTGTGGCTGGTTTGCTGG + Intergenic
1130588394 15:85197736-85197758 CAGGCCTGTGGCTGGTTTGCTGG - Intergenic
1131224388 15:90611908-90611930 CAGGCTGCTGGTCATTTGGCAGG - Intronic
1132325455 15:100965060-100965082 CAGGCAGCTCACTGTTCTGCAGG - Intronic
1132643536 16:988567-988589 CCGGCTGGTGGGGGTTTTGCTGG + Intergenic
1132879980 16:2157839-2157861 CAGCCTGCTGGCTGTGTCCCTGG + Intronic
1133324173 16:4933338-4933360 CAGGCTGCTGGGTGTTTACTGGG + Intronic
1134572232 16:15300900-15300922 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134572296 16:15301549-15301571 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134730149 16:16455148-16455170 CAGGCTGCTGATTGTTCTGAGGG - Intergenic
1134937282 16:18256751-18256773 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134937348 16:18257401-18257423 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1137232737 16:46582605-46582627 CTGGCTGCTGGCTGTTTGCTGGG - Intronic
1137574189 16:49587567-49587589 CAGGCAGCTGGCTGTTGGGGTGG + Intronic
1140040895 16:71407076-71407098 AATGCTGCTGGCTGTTTTCAAGG - Intergenic
1140554847 16:75910009-75910031 CAGCCTGCTGTTTCTTTTGCAGG - Intergenic
1141875879 16:86824121-86824143 CAGGCTGGTGGCTATTTTCAAGG + Intergenic
1142698006 17:1644087-1644109 CAGGCTGCCGGATGTTCTGAGGG - Intronic
1143910347 17:10243815-10243837 AAGGCAGCTGGCTGTGGTGCAGG + Intergenic
1144638075 17:16923621-16923643 CATGCTGCTGGCTGGCTGGCTGG + Intergenic
1145211593 17:21017299-21017321 CAGGCTGGTGCCTGTTCTTCAGG - Intronic
1145817728 17:27807683-27807705 CACGCCCCTGGCTGTTCTGCAGG + Intronic
1147315744 17:39619228-39619250 GAGGGGGCTGGCTGCTTTGCAGG + Intergenic
1149641328 17:58204817-58204839 CAGGCTGCTGACGCTTCTGCTGG + Exonic
1150481618 17:65515701-65515723 CCCGCTGTTGGCTGTTGTGCTGG - Intergenic
1150617646 17:66784665-66784687 CAGGCTGCGTGCTGTTAGGCAGG + Intronic
1150637125 17:66921200-66921222 CTGGCTGCTGGCTGTGATGCTGG - Intergenic
1151380946 17:73725455-73725477 TAGGCTGCTGTCTCTTTTGGAGG + Intergenic
1151956193 17:77381342-77381364 CAGACTGCTGGCTGTTGACCTGG - Intronic
1152906707 17:82974434-82974456 GAATCTGCTGGCTGCTTTGCGGG - Intronic
1153081478 18:1231440-1231462 CAGGCAGGTCCCTGTTTTGCAGG + Intergenic
1154294428 18:13136775-13136797 CAGGCTGCAGGCTGCTTGCCCGG - Intergenic
1156711965 18:39958005-39958027 CCCGCTCCTGGCTGTTTTGACGG - Intergenic
1159134924 18:64326421-64326443 CAGGCTGCTTGGAGTTTTTCTGG + Intergenic
1160318760 18:77871013-77871035 CATGCCTCTGGCTGCTTTGCTGG - Intergenic
1160458999 18:79023271-79023293 CAGGCTGCTGGCTCCTCTGCAGG - Intergenic
1163313396 19:16527251-16527273 GATGGTGGTGGCTGTTTTGCAGG - Intronic
1164508565 19:28879029-28879051 CAGGCTCCTGCCTGTGCTGCTGG - Intergenic
1164676424 19:30104615-30104637 CAGGGTGGTGGCCTTTTTGCTGG + Intergenic
1168357558 19:55711889-55711911 CAGGCTCCTCAGTGTTTTGCAGG + Exonic
926009598 2:9397639-9397661 CAGCCTGCTGCCTGTTTTTTAGG + Intronic
926121578 2:10243863-10243885 CAGGCTGCTGGCGGAATTACAGG - Intergenic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
929248801 2:39730590-39730612 CAGGCTGGTGGCAGTATTGGTGG + Intergenic
930001087 2:46861878-46861900 GAGGCTGCTGTCTGAGTTGCTGG + Intergenic
935281537 2:101522011-101522033 CAGGCTGGTGGCTCTGGTGCAGG + Intergenic
937890591 2:126935493-126935515 AAGGCTGCTGGCTGTGTGTCTGG - Intergenic
937987807 2:127646319-127646341 CAGGCTGCTGCCTGTCTCCCTGG - Intronic
942120212 2:172769392-172769414 CAGGCTACTGTCTGTTCTTCAGG - Intronic
942461170 2:176169845-176169867 CAGGCTGCTGGTGCTGTTGCTGG + Intronic
944928531 2:204491656-204491678 CAAGCTGCTGGCTGAATTCCAGG + Intergenic
945963159 2:216157049-216157071 CAGTCTGGTGGCTTTGTTGCTGG - Intronic
945969032 2:216218450-216218472 GAGGCAGCTGTCTGTTTTGTAGG - Intergenic
946050955 2:216862132-216862154 CAGGCTGCTGGCTTGCTTGTTGG + Intergenic
946994404 2:225374818-225374840 AAGGCTGCAGGCAGTTTGGCTGG + Intergenic
948588139 2:239034141-239034163 CAGGCTGCTGTCAGTTTGGATGG + Intergenic
948896698 2:240931023-240931045 CAGGGTGCTGGCCGTGCTGCTGG - Exonic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1170423473 20:16215311-16215333 GTGGCTGCTGCCTGTTTTGAGGG + Intergenic
1170571166 20:17633613-17633635 CGGGCTGGTGACTGTCTTGCAGG - Exonic
1171121305 20:22571395-22571417 CCAGCTGCTGGACGTTTTGCAGG - Intergenic
1174584489 20:51597263-51597285 CACGCTGCAGGATGCTTTGCAGG + Exonic
1174654271 20:52157369-52157391 AAGGCTGGTGACAGTTTTGCTGG - Intronic
1174868956 20:54165730-54165752 GAGGCTGCTTACTGTTTTGATGG + Exonic
1175177422 20:57120572-57120594 CAGGCTGCTGGGGGTGTTGATGG + Intergenic
1175303736 20:57961417-57961439 CAGGCTCCTGGCTGTGGTCCTGG - Intergenic
1175760381 20:61558796-61558818 GAGGCTGCTGTGTGTGTTGCAGG - Intronic
1175855736 20:62119997-62120019 CAGGCTTCTGGCTGTGTTGGGGG - Intergenic
1175914643 20:62419957-62419979 CAGGGTGCTGGCTGCCGTGCGGG + Intronic
1176060765 20:63171760-63171782 CAGGCTGCTGTCTGCTTTTAGGG - Intergenic
1176390306 21:6159812-6159834 CAAGCTGCTGGCTGCAGTGCAGG - Intergenic
1176429862 21:6568931-6568953 CAGGCTACAGGCTGCTGTGCAGG - Intergenic
1178533010 21:33390867-33390889 CTGCCTTCTGGCCGTTTTGCTGG + Intergenic
1179302348 21:40123933-40123955 CAGGCTGCTGGCAGTTTAGTGGG + Intronic
1179705256 21:43176393-43176415 CAGGCTACAGGCTGCTGTGCAGG - Intergenic
1179733160 21:43378428-43378450 CAAGCTGCTGGCTGCAGTGCAGG + Intergenic
1181770311 22:25120333-25120355 CAGGCTGCTTTCTTTTTGGCTGG + Intronic
1182787765 22:32921915-32921937 CAGGCTGCAGGCTGCCTTGGTGG - Intronic
1183047240 22:35229814-35229836 CAGGATGCTAGCTGTTTCTCAGG - Intergenic
1183858377 22:40652043-40652065 CCGGCCGCTGGCTGCTTGGCAGG + Intergenic
1184121045 22:42450576-42450598 CATGCAGCTGGCTCATTTGCTGG + Intergenic
1184132878 22:42528302-42528324 CATGCAGCTGGCTCATTTGCTGG + Intergenic
1184333593 22:43840715-43840737 CACGGTGCTGGCTGCTTTACAGG - Intronic
1184408901 22:44315428-44315450 CAGGCTGCTGGGTGTGGTGCCGG + Intergenic
1184876636 22:47280128-47280150 CACGATGCTGGATGCTTTGCAGG + Intergenic
952919623 3:38275741-38275763 TGGGCTGGTGGCTGTTTGGCTGG + Intronic
953709877 3:45260873-45260895 CAGGCTGCTGGATGCATGGCAGG + Intergenic
953810646 3:46109536-46109558 CAGGGTGCTGGCTGGTGTGGTGG + Intergenic
955418495 3:58714877-58714899 CAGGTAGCTGGCTGATCTGCCGG + Intergenic
956876733 3:73471260-73471282 CTAGCTGCTGGATGGTTTGCCGG - Intronic
960082210 3:113553682-113553704 CAGGCTGTTGGCTGCCTTCCAGG + Intronic
960895818 3:122503927-122503949 GTGGCTGCTGGGTGTTTTGGGGG + Intronic
962623985 3:137207128-137207150 GACTTTGCTGGCTGTTTTGCAGG - Intergenic
963860735 3:150307813-150307835 CTGGTTTCTGGCTGTTTTGGTGG + Intergenic
968067032 3:195764417-195764439 TAGGGTGCTGTCTCTTTTGCAGG + Intronic
968131388 3:196194684-196194706 CAGGCACCTGGCGGCTTTGCAGG + Intergenic
968645651 4:1739466-1739488 GAGGCTGCTGGCTGTGCTCCTGG - Intronic
969042117 4:4307244-4307266 CTGGCTGCTGGGTGTTCTCCTGG - Intronic
970621417 4:17823650-17823672 AAAACTGCTGGCTGTTTTACAGG + Exonic
972018480 4:34277367-34277389 CTGGTTGCAGGCTGTTTTGTTGG + Intergenic
972559992 4:40218486-40218508 CAGGCTGAGGGCTTTTTTGCAGG + Intronic
972765563 4:42150730-42150752 CAGGCAGTGGGCTGCTTTGCCGG + Intronic
975949071 4:79746286-79746308 GAGGCTGCTGGGTGTTTTCTGGG - Intergenic
978153961 4:105468662-105468684 TAGGAGGCTGGCTGTTATGCTGG + Intronic
979277913 4:118834121-118834143 CAGGCTACTGGCAGTTATGGTGG - Intronic
979297834 4:119053156-119053178 CAGGCTGTTCTCTGTTTGGCTGG - Intronic
980132727 4:128831730-128831752 CAGGCTGCCTGCTGTTTCCCGGG + Exonic
980457213 4:133060320-133060342 CAGGGAGCTGGCTCTTTTACAGG - Intergenic
980810136 4:137866963-137866985 CAAGCTGCTGCCTTTTTAGCTGG - Intergenic
982271699 4:153596485-153596507 CAGGATGAAGGCTGTGTTGCGGG + Intronic
985970801 5:3377117-3377139 CAGGCTGCTGGGCGTCATGCTGG + Intergenic
987362525 5:17120148-17120170 CAGGCCGCTGGCTCTTCTGGAGG - Intronic
991003972 5:61809804-61809826 CAAGCAGCTGGCTTTTTGGCTGG - Intergenic
997400855 5:133601086-133601108 CAGGCTGCTCACAGATTTGCTGG + Intronic
997411609 5:133695337-133695359 GAGGGTGCTTGCTGTTGTGCTGG - Intergenic
1001083445 5:168683692-168683714 CAGGCAGCTGGCTACTGTGCGGG - Intronic
1002125683 5:177042211-177042233 CAGGCTGCTTGCTTTCTTGAGGG + Intronic
1003343605 6:5244914-5244936 CAGGCTGAGGGCTGTTTTCCTGG + Intronic
1003521490 6:6862353-6862375 CAGGCTGCTGCCTGGTCTCCTGG - Intergenic
1005852552 6:29832638-29832660 CAGGGAGGTGGCTGTTGTGCTGG + Intergenic
1005876141 6:30011161-30011183 CAGGAAGGTGGCTGTTGTGCTGG + Intergenic
1006641422 6:35491620-35491642 CAGCCTGCTGGCGGGTTTGCAGG - Intronic
1007584282 6:42979129-42979151 CATGGCGCTGGCTGTCTTGCGGG - Exonic
1008002459 6:46375065-46375087 TGGGCTGCTGGCTGTAATGCCGG - Intronic
1008011076 6:46468499-46468521 CAGGATGGGGGCTGCTTTGCTGG - Intronic
1010851273 6:80781411-80781433 CAGGCTTATGGCTGTTCAGCTGG + Intergenic
1012836101 6:104270625-104270647 ATAGCTGCTGGCTGTTTTGGGGG - Intergenic
1013039374 6:106418387-106418409 CAGGCTTCAGGCTGTTTTTTTGG + Intergenic
1016362855 6:143286789-143286811 CAGGCTGCTGGCTGTTTTGCTGG + Intronic
1017775814 6:157680049-157680071 CGTGCAGCTGGCTGTATTGCAGG + Intergenic
1023364484 7:39450226-39450248 CAGACTGGTGCCTGTTTTGGGGG + Intronic
1024528354 7:50369578-50369600 CAGTTTGGTTGCTGTTTTGCGGG - Intronic
1026533384 7:71219912-71219934 CAGGTGGATGGCTGTTTTGCTGG + Intronic
1028731610 7:94157611-94157633 CAGGCTGCTGACTATTTTTATGG + Intergenic
1029648177 7:101871472-101871494 GAGGCTGCTCGCTGTGCTGCAGG - Intronic
1031136742 7:117892848-117892870 CAGGCTGTTGTCTGTTGTTCAGG + Intergenic
1032186077 7:129727805-129727827 CAGGCAGCAGGCTGTGATGCCGG + Intronic
1034464369 7:151217880-151217902 GAGGCTGGGGGCTGTTTTCCTGG - Intronic
1035779670 8:2217425-2217447 CAGGCTGCTGTCTGGTTTTCTGG - Intergenic
1037727425 8:21494554-21494576 CAGGCAGCTGGCAAATTTGCAGG - Intergenic
1039890192 8:41680728-41680750 CAGGTAGCTAGCTGTATTGCTGG + Intronic
1041760837 8:61364417-61364439 CAACTTGTTGGCTGTTTTGCAGG - Intronic
1045474062 8:102538248-102538270 CAGGCTGCTGTCTCTTGTGAGGG + Intronic
1047788993 8:128183124-128183146 CAGGCTGTTAGATGTTTTCCAGG + Intergenic
1047818970 8:128497188-128497210 CTGTCTGAAGGCTGTTTTGCAGG + Intergenic
1048400553 8:134064596-134064618 CAAGCTGCGGGATTTTTTGCAGG - Intergenic
1048861402 8:138726917-138726939 CAGACTGCAGGCTGCTTTCCTGG - Intronic
1048906520 8:139094475-139094497 CAGCCTGCTGGATTATTTGCAGG - Intergenic
1049731473 8:144180663-144180685 GAGGCTGCTGGCTGGTTGGGGGG + Intronic
1052565629 9:30146453-30146475 CAGGTTGCAGACTTTTTTGCTGG - Intergenic
1053024198 9:34716987-34717009 CAAGTTGTTGGCTGTTTTCCAGG + Intergenic
1053147106 9:35719175-35719197 GAAGCTGCTGGCTGCCTTGCTGG - Exonic
1053185696 9:36014252-36014274 GAGGCTGCTGGTTAGTTTGCTGG + Intergenic
1056464591 9:86841352-86841374 CAGGCTGTTTCCTGTTTTGTGGG - Intergenic
1057214709 9:93221225-93221247 CTTGCTGCTGGCTCTTATGCTGG + Intronic
1059018061 9:110543670-110543692 CAGGCCACTGGCTGTTTGGCAGG + Intronic
1059718798 9:116938506-116938528 CTGGCTGCTGGCAGTTTCACAGG + Intronic
1060890764 9:127186747-127186769 GAGGCTGCAGGCTTTTCTGCTGG + Intronic
1062480446 9:136748453-136748475 CCTGCTGCTGGCTGCTTTTCTGG - Exonic
1185749144 X:2596708-2596730 AAGGCTGCTGGGGTTTTTGCAGG + Intergenic
1186924152 X:14313694-14313716 CAGGTTGCTGGCTGGTCTTCTGG + Intergenic
1189006519 X:37000278-37000300 CAGGCTGGTTGGTGTTTTCCTGG - Intergenic
1189042119 X:37553731-37553753 CAGGCTGGTTGGTGTTTTCCTGG + Intronic
1195320932 X:103721504-103721526 CAGGCTGCTGCCTCTATTTCAGG + Intronic
1195570117 X:106391510-106391532 CAGCCTGCTGGCTTCTTTGCAGG + Intergenic
1196737408 X:118992099-118992121 CAGGCTGCTGTTCGTTGTGCTGG + Intronic
1197638876 X:128946623-128946645 CAGGCTGCTGGATGTACTTCTGG - Intergenic
1198035082 X:132794003-132794025 AAGGCTACTTGCCGTTTTGCTGG + Intronic
1200284092 X:154804498-154804520 GAGGCTGCTGGTTGATTTTCTGG + Intronic