ID: 1016365342

View in Genome Browser
Species Human (GRCh38)
Location 6:143310377-143310399
Sequence GCACACTAATAAATAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 11, 3: 66, 4: 407}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016365341_1016365342 0 Left 1016365341 6:143310354-143310376 CCAAAGTATTTGGAAATTAAATA 0: 3
1: 28
2: 144
3: 377
4: 1216
Right 1016365342 6:143310377-143310399 GCACACTAATAAATAACCCATGG 0: 1
1: 0
2: 11
3: 66
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016365342 Original CRISPR GCACACTAATAAATAACCCA TGG Intronic
902112016 1:14088389-14088411 ACACATTTCTAAATAACCCATGG - Intergenic
903290180 1:22306953-22306975 ACACACTTCTAAATAACTCAAGG + Intergenic
905606658 1:39306704-39306726 GTACACTAATAAATAAGACTTGG - Intronic
905638887 1:39575530-39575552 CAACACTAATAAGTAGCCCAAGG + Intronic
906262037 1:44400370-44400392 GCACAACACTAAATAAACCAGGG - Intergenic
906832319 1:49046118-49046140 GTACAATAATAAATAAGACAAGG + Intronic
908209758 1:61888175-61888197 GCACAGTGATAAATAAGCAAAGG + Intronic
909211158 1:72825937-72825959 ACACACTTCTAAATAACACATGG + Intergenic
909796747 1:79749039-79749061 GCACTCTAAAAAATAACCCATGG + Intergenic
910222518 1:84902078-84902100 ACACACATATAAATAACCCATGG + Intergenic
910307007 1:85776195-85776217 ACACACTTCTAAATAATCCATGG - Intronic
910553688 1:88505652-88505674 GCATATTTATAAATGACCCAGGG - Intergenic
910972919 1:92874533-92874555 GCACATTAATAGATATTCCATGG - Intronic
911651748 1:100396778-100396800 GCACACTCAAAAGTAAGCCATGG - Intronic
911935788 1:103970279-103970301 ACACACTCTTAAATAACCAATGG - Intergenic
912772331 1:112476177-112476199 ACACACTACCAAATAACCCATGG + Intronic
912904168 1:113686516-113686538 GCATACTAAAAATAAACCCACGG + Intergenic
913032932 1:114930074-114930096 TCAGACTAATAAATAATTCATGG + Intronic
914965174 1:152250643-152250665 CAACACTGATAAATAACCAATGG - Intergenic
915292146 1:154892328-154892350 ACACACTTCCAAATAACCCATGG + Intergenic
916036952 1:160930834-160930856 GCAAACAAACAAAAAACCCAAGG - Intergenic
916603614 1:166318639-166318661 GCACACTTCTAAATAACACATGG - Intergenic
917233244 1:172861128-172861150 GCATATTTATAAATAATCCATGG + Intergenic
918799232 1:188951018-188951040 GCTCACTTCTAAATAATCCATGG - Intergenic
919031942 1:192252746-192252768 ACACACTATTAAATAACCAATGG - Intergenic
919581100 1:199374150-199374172 ACACACTTCTAAATAACCTATGG + Intergenic
920999468 1:211028213-211028235 TCACACTTCTAAATAATCCATGG + Intronic
921674137 1:217959096-217959118 GCACATTTATAAATAACACATGG + Intergenic
922108697 1:222535884-222535906 GCACACTTTGAAATAACTCATGG + Intronic
923347505 1:233069593-233069615 GCACAATTCTAAATAAACCATGG + Intronic
923626989 1:235622216-235622238 ACACACTTCTAAATAGCCCATGG - Intronic
923743249 1:236675312-236675334 GCACACTTATAAAAAACAAATGG + Intergenic
923878735 1:238079723-238079745 ACACACTATTAAATAACCAGTGG - Intergenic
923888364 1:238182756-238182778 GCACACTTCTAAATAATCCATGG - Intergenic
924126588 1:240859964-240859986 ACACACTTCTAAATAACACATGG - Intronic
1063976355 10:11419664-11419686 ACACACTGCTAAATAACACACGG + Intergenic
1064484965 10:15777084-15777106 ACACACTAATGAATTACCAAAGG - Intergenic
1064977239 10:21130620-21130642 ACACACTTCTAAATAACACATGG + Intronic
1065086021 10:22177654-22177676 GCACACTTCTAAGTAAGCCATGG + Intergenic
1065179793 10:23113384-23113406 GCAGATTAAAAAAAAACCCATGG - Intronic
1065989762 10:30996927-30996949 CCACACTCCTAAATAACCAATGG + Intronic
1066069360 10:31790820-31790842 ACATACTTTTAAATAACCCATGG - Intergenic
1068467552 10:57414284-57414306 GAATACTTATAAATAACACAGGG + Intergenic
1068765784 10:60762195-60762217 ACACACTTCTAAATAACCCTGGG + Intergenic
1070080768 10:73184657-73184679 TCACTCTTCTAAATAACCCATGG + Intronic
1071047189 10:81395295-81395317 ACACACTTCTAAATAACACATGG - Intergenic
1071472935 10:85998369-85998391 GCACACTTATAAATAATCCATGG + Intronic
1071595664 10:86921928-86921950 GTACACTTAAAAATAACTCAAGG - Intronic
1071754070 10:88515984-88516006 GGACACTAAGAAATACACCAAGG + Intronic
1071987915 10:91071449-91071471 GCTCACTGATAAATAAGGCATGG - Intergenic
1073039307 10:100590321-100590343 ACACACTTGTAAATAATCCATGG + Intergenic
1074196628 10:111193257-111193279 ACACATTTCTAAATAACCCATGG - Intergenic
1074484659 10:113863349-113863371 GCACACTCTTAAATAACCAGTGG + Intronic
1075478703 10:122760009-122760031 GAACTCTAATTAATAACCTAGGG + Intergenic
1077361422 11:2142102-2142124 GCACACTAAAAAATGTCCCTGGG - Intronic
1078042173 11:7877495-7877517 ACACACCCATAAATAACCAAAGG + Intergenic
1078992175 11:16660353-16660375 ACATACTTATAAATAACACATGG - Intronic
1079459183 11:20665116-20665138 GCACTCTAAAAAATAAAGCAGGG + Intergenic
1080088005 11:28309789-28309811 GCACAGAAAAAAATGACCCAGGG - Intronic
1080732209 11:34968723-34968745 TCACACTTATAAACAACTCATGG - Intronic
1080775090 11:35378733-35378755 CCAGACTAATATATAACCCGTGG + Intronic
1080850493 11:36064780-36064802 ACACACTCCTAAATAACCAATGG - Intronic
1081301984 11:41463701-41463723 ACACACTTATAAATAAACCATGG - Intergenic
1082740331 11:56904021-56904043 GGACACTAATACCTAACTCACGG - Intergenic
1082984797 11:59159190-59159212 GGACACTAGTAAACATCCCAAGG - Intergenic
1083240715 11:61386238-61386260 ATACACTTATAAATAGCCCATGG + Intergenic
1083575548 11:63788394-63788416 ACACACTTCTAAATAACACATGG + Intergenic
1083715492 11:64572910-64572932 ACACACTTCTAAGTAACCCACGG + Intergenic
1085078875 11:73617289-73617311 GTATACTACTAAATAACCCATGG - Intergenic
1086723842 11:90156867-90156889 ACACATTTATAAATAAACCATGG - Intronic
1087054993 11:93925831-93925853 ACACACTTTTAAATAACACATGG + Intergenic
1087465584 11:98500494-98500516 TCACAATAATATATAACCTAGGG - Intergenic
1087672094 11:101119279-101119301 GCACACTAATCATTTACACAAGG - Intronic
1088093295 11:106068377-106068399 ACACACTTCTAAATAATCCATGG + Intronic
1090518247 11:127451523-127451545 GAACACAAAGAAAAAACCCAAGG + Intergenic
1090986006 11:131766697-131766719 TCACACATATATATAACCCAAGG - Intronic
1091083192 11:132692556-132692578 GAAAATTAATAAATCACCCAGGG + Intronic
1091830483 12:3546079-3546101 GCACTCTGCTAAATAGCCCATGG + Intronic
1092575209 12:9775211-9775233 GCAAACTTCTAAATAACCAATGG - Intergenic
1092730486 12:11528569-11528591 ACCCAATTATAAATAACCCATGG - Intergenic
1093129864 12:15377877-15377899 ACACACTTCTAAATAACCAATGG + Intronic
1093239358 12:16650395-16650417 ACACACTTTTAAATAACACATGG + Intergenic
1093697982 12:22184351-22184373 GCATACTTTTAAATAACACATGG + Intronic
1094256540 12:28435363-28435385 ACACACTTCTAAATAACTCATGG - Intronic
1094314735 12:29127104-29127126 ACACACTTCTAAATAACACATGG - Intergenic
1094766765 12:33605227-33605249 GTATACTTTTAAATAACCCATGG + Intergenic
1095509803 12:42938469-42938491 GCACATTTCTAAATAACCCATGG - Intergenic
1096327211 12:50674742-50674764 GCCCACTAATAACTAATCCTGGG + Intronic
1098150598 12:67542585-67542607 GCACAAAAATAAATAAGACATGG + Intergenic
1098832842 12:75383905-75383927 GCACACTTCTAAATAACACATGG + Intronic
1099820901 12:87708341-87708363 GCACATTATAAAATAACACATGG + Intergenic
1100299008 12:93290227-93290249 GCACACCAACAGATAACACAAGG + Intergenic
1101082149 12:101198060-101198082 ATACACTTATAAATAACCCATGG + Intronic
1103425238 12:120828206-120828228 ACACACTCCTAAATAACCCATGG + Intronic
1104263508 12:127207919-127207941 ACACACTTCTAAATAACCCATGG - Intergenic
1105333648 13:19442314-19442336 GCACACTTCTACATAACTCATGG + Intronic
1105567153 13:21561051-21561073 ACACACTTTTAAATAACACATGG - Intronic
1105717146 13:23078449-23078471 GCACAATTCTAAATAATCCATGG - Intergenic
1105770183 13:23602744-23602766 ACACACTTCTAAATAACACATGG + Intronic
1106306112 13:28511726-28511748 ACACACTTCTAAATAACACATGG - Intergenic
1106985126 13:35337857-35337879 GGAAACTACTAAATAACCAATGG + Intronic
1107261102 13:38492558-38492580 GCACACTTTTAAATAACTCATGG - Intergenic
1107302036 13:38976169-38976191 GCACACTATTAAGTTACTCAAGG - Intronic
1108931436 13:55827720-55827742 ACACACTACTAAATAATCAATGG + Intergenic
1109935167 13:69273037-69273059 GCACAAAAATAAATAACAAAAGG + Intergenic
1110350276 13:74499252-74499274 GCACATTTATCAATAATCCATGG - Intergenic
1111554078 13:89856863-89856885 GCAAACTCACAAATTACCCATGG - Intergenic
1111834209 13:93367688-93367710 ACACACTATTAAATAATCTATGG - Intronic
1112231941 13:97596833-97596855 ACACACTTCTAAATAACCAATGG + Intergenic
1113475729 13:110579498-110579520 GCACACTTCTAAATAACGCATGG - Intergenic
1113705361 13:112428269-112428291 GCACACTTCTAAACAACCTATGG - Intronic
1114901225 14:27061427-27061449 GCACACTTCTAAATAATGCAAGG - Intergenic
1115686339 14:35800473-35800495 ACAGACTTGTAAATAACCCATGG + Intronic
1115719946 14:36149242-36149264 ACACACTTTTAAATAACACATGG - Intergenic
1116365986 14:44064062-44064084 GCATACTACTAAATAACAAATGG + Intergenic
1116797225 14:49404685-49404707 GGACACCAATAAATCTCCCAGGG + Intergenic
1116955693 14:50920917-50920939 GCACACGCATAAAGAAACCAAGG + Intronic
1117125786 14:52624191-52624213 GCACAATTCTAAATAACCCATGG + Intronic
1117241021 14:53832941-53832963 ACACACTTCTAAATAACTCATGG + Intergenic
1118727857 14:68642859-68642881 ACACACTTATAAATAACATATGG - Intronic
1119013032 14:71016613-71016635 AAACACTTCTAAATAACCCATGG + Intronic
1119882206 14:78109166-78109188 GCATACTTCAAAATAACCCATGG - Intergenic
1121716075 14:96076902-96076924 ACACACTCCTAAATAATCCATGG - Intronic
1122260077 14:100512839-100512861 GCACACTTCTAAATAAATCATGG - Intronic
1123471414 15:20556734-20556756 CAACACTTATAAATATCCCATGG + Intergenic
1123646589 15:22443634-22443656 CAACACTTATAAATATCCCATGG - Intergenic
1123697119 15:22886542-22886564 GCACACTTTTAAATAATCCTTGG - Intronic
1123731716 15:23151729-23151751 CAACACTTATAAATATCCCATGG + Intergenic
1123749853 15:23349112-23349134 CAACACTTATAAATATCCCATGG + Intergenic
1124054447 15:26229198-26229220 ACACATTTCTAAATAACCCATGG + Intergenic
1124282222 15:28373007-28373029 CAACACTTATAAATATCCCATGG + Intergenic
1125135727 15:36339907-36339929 GCACACTTCTAAATGACACATGG - Intergenic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1126340169 15:47632040-47632062 ACACACTTCTAAATAACCCATGG - Intronic
1126526522 15:49662009-49662031 GCACACTTCTAAATAACCCATGG - Intergenic
1127323479 15:57870224-57870246 ACACACTGCTAAATAATCCATGG + Intergenic
1127597256 15:60498197-60498219 GCAGACTCATACAGAACCCAAGG + Intronic
1128239006 15:66087723-66087745 GAACACAAATAGATAACCTAAGG + Intronic
1128406607 15:67346909-67346931 ACACACTTCTAAATAACCCGTGG + Intronic
1128523797 15:68394345-68394367 ACACATTTCTAAATAACCCACGG + Intronic
1128870345 15:71150430-71150452 GCACAGCAATATATAACCCCAGG - Intronic
1129866616 15:78913954-78913976 GTACAATATTAAATAACACATGG - Intergenic
1130161414 15:81404554-81404576 CCACTCTAATCAATTACCCATGG - Intergenic
1130181230 15:81630717-81630739 GAACATTAATGAATTACCCAAGG + Intergenic
1130262420 15:82366723-82366745 TAATAATAATAAATAACCCAAGG - Intergenic
1130278810 15:82502284-82502306 TAATAATAATAAATAACCCAAGG + Intergenic
1131139714 15:89967275-89967297 ACACACTTTTAAATAACCAAAGG + Intergenic
1131557224 15:93410280-93410302 GGACATTAAAAAATAAGCCAAGG - Intergenic
1132496929 16:268325-268347 GCACACAAATAAAAGACCCTTGG - Exonic
1134817216 16:17215619-17215641 GCAGACTAATATACAACTCAAGG + Intronic
1135697213 16:24599589-24599611 ATACACTTCTAAATAACCCATGG - Intergenic
1135727392 16:24867254-24867276 ACACACTTCTAAATAACCAATGG + Intronic
1138174849 16:54887859-54887881 GCACACTCAAAAATTCCCCATGG + Intergenic
1138592391 16:58008901-58008923 ACACACTTCTAAATAACACACGG - Intronic
1139307579 16:66000531-66000553 GCACACTGAAAAATCATCCAAGG - Intergenic
1139586268 16:67905973-67905995 GCACAGGAATAAATAAAACATGG - Intronic
1142506419 17:366403-366425 ACACACTCCTAAATAACCAATGG - Intronic
1143255190 17:5552251-5552273 ACACACTCCTAAATAACCAAGGG - Intronic
1145875539 17:28316411-28316433 GCCCACTATTAAATAACATAAGG + Intergenic
1146463795 17:33069093-33069115 ACACACTTCTAAATAATCCATGG - Intronic
1146464633 17:33076478-33076500 TCACACTTATAAATATGCCAGGG + Intronic
1149133642 17:53339485-53339507 ACACACTGATAAATAACAAAGGG + Intergenic
1150089523 17:62310582-62310604 ACACATTTCTAAATAACCCATGG - Intergenic
1150543100 17:66123787-66123809 ACACACTTCTAAATAATCCAGGG - Intronic
1151191252 17:72399711-72399733 GCAAACTAATAAATCCCCTATGG + Intergenic
1152986487 18:326229-326251 ACACATTTCTAAATAACCCATGG - Intronic
1153142520 18:1989989-1990011 CCACACTTCTAAATAACTCATGG + Intergenic
1153987465 18:10366247-10366269 GCACATTACTAAATAACAGATGG + Intergenic
1155082842 18:22427975-22427997 GCAAATAAATAATTAACCCAAGG + Intergenic
1155089884 18:22496640-22496662 ACCCACTTATAAATAATCCATGG + Intergenic
1155574090 18:27226114-27226136 GCACACCAACAAATAACACGAGG - Intergenic
1155741032 18:29287932-29287954 TAACACTCCTAAATAACCCATGG + Intergenic
1155786621 18:29911129-29911151 ATACACTTTTAAATAACCCAAGG - Intergenic
1156380492 18:36555288-36555310 ACACACTTCTAAATAACCCAGGG - Intronic
1156430640 18:37070080-37070102 TAACACTTCTAAATAACCCATGG - Intronic
1158976985 18:62717771-62717793 CCACACTCATAAATTACCCACGG + Intronic
1159245353 18:65798535-65798557 GCACACCAATAAATTCCCTATGG - Intronic
1160275671 18:77431879-77431901 GCACACTTCTAAATAACCAAGGG - Intergenic
1160311582 18:77796972-77796994 ACACACTTCTAAATAATCCATGG - Intergenic
1160312205 18:77805800-77805822 GCATATTTCTAAATAACCCAAGG - Intergenic
1164208426 19:23076569-23076591 GCCCTCTAAGAAATGACCCAGGG - Intronic
1164935960 19:32212716-32212738 ACACACTTCTAAATAATCCATGG + Intergenic
1168541538 19:57215767-57215789 GCATACTATTAAATAATTCATGG - Exonic
925229159 2:2216395-2216417 ACACATTTCTAAATAACCCATGG + Intronic
926546924 2:14253295-14253317 GTTCACTACTAAATAAACCATGG - Intergenic
927227451 2:20783073-20783095 ACACACTTTTAAATAACACATGG - Intronic
927376373 2:22419761-22419783 ACACACCAATAAACAACACAAGG + Intergenic
927618531 2:24625767-24625789 ACACACTTCTAAATAATCCATGG - Intronic
927770832 2:25859844-25859866 GCACACTTCTAAATAACACATGG + Intronic
928080280 2:28305984-28306006 GCACAACTATAAATAACCCATGG - Intronic
928847533 2:35695668-35695690 GCCTTCAAATAAATAACCCAAGG - Intergenic
928901843 2:36326974-36326996 ACACACTCCTAAATAACCAATGG + Intergenic
929067101 2:37988902-37988924 GGAAACAAATAAATGACCCATGG + Intronic
930042460 2:47138239-47138261 ACACACTTCTAAATAACACATGG - Intronic
930132366 2:47865486-47865508 GCAGACTAATAAATAAAACAGGG + Intronic
930148869 2:48037091-48037113 GCATACTTCTAAATAACCCATGG - Intergenic
931029083 2:58150881-58150903 ACATACTAATAAATAATCCATGG - Intronic
932924955 2:75962673-75962695 ACACACTTCTAAATAACACATGG + Intergenic
933342179 2:81037867-81037889 GCACATCAATAAATAATTCATGG - Intergenic
933765186 2:85703180-85703202 ACACACTCCTAAATAACCAATGG - Intergenic
934986421 2:98889892-98889914 ACACACTCCTAAATAACCAATGG + Intronic
935366669 2:102299520-102299542 ATACACTTTTAAATAACCCATGG - Intergenic
935848392 2:107191369-107191391 ACACACTTCTAAATAACACATGG + Intergenic
935917845 2:107976456-107976478 TCACACTAATAAAAATCCAAAGG + Intergenic
936231817 2:110709043-110709065 GCACACTCTTAAATAACTGATGG - Intergenic
936280273 2:111133486-111133508 ACACACTTCTAAATAACCTAGGG - Intronic
936889750 2:117355349-117355371 GCAAACTAATGAAACACCCAGGG - Intergenic
937168985 2:119845944-119845966 GCACACTCATAAATAACCAAGGG - Intronic
937353233 2:121181777-121181799 ACACACTTCTAAATAACTCATGG + Intergenic
937799601 2:126066677-126066699 ACACACTTCTAAATATCCCATGG + Intergenic
937892900 2:126953245-126953267 ACATACTTCTAAATAACCCATGG - Intergenic
938142338 2:128805969-128805991 ACACACTTCTAAATAATCCATGG - Intergenic
939971660 2:148669106-148669128 ACACACTTCTAAATAACCTATGG - Intronic
940853493 2:158710325-158710347 GCACACTTCAAAATAATCCATGG - Intergenic
941029065 2:160492371-160492393 GCCCACTAACAAAGTACCCAGGG + Intronic
941206043 2:162574636-162574658 GAACACTACTAAAGAACCCATGG - Intronic
942207544 2:173635444-173635466 GCACACTTCTAAATAATCTATGG + Intergenic
943511709 2:188835162-188835184 ACATACTTGTAAATAACCCATGG + Intergenic
945143261 2:206710045-206710067 ACAAATGAATAAATAACCCATGG - Intronic
945489807 2:210441832-210441854 ACACATTAAGAAATAAACCAAGG - Intronic
945692435 2:213054880-213054902 CCACACTAGTAAATAACAAAAGG + Intronic
947035949 2:225855202-225855224 GCATACTTGTAAGTAACCCATGG - Intergenic
947184224 2:227440484-227440506 ACACACTTTTAAATAATCCATGG + Intergenic
1169290920 20:4351754-4351776 GCACACTCTTAAATAAACAATGG - Intergenic
1169551913 20:6709759-6709781 GCACACAAATACACAACACAGGG - Intergenic
1169579906 20:7009385-7009407 GCATTCTTCTAAATAACCCATGG - Intergenic
1169754413 20:9028247-9028269 ACACACTTATAAATAACCCATGG + Intergenic
1170376646 20:15707833-15707855 TCACACTAATAAATATCTAAAGG - Intronic
1171219898 20:23386056-23386078 AAACACTACTAAATAATCCATGG + Intronic
1172172478 20:32947583-32947605 ACACATTTCTAAATAACCCATGG + Intronic
1175630926 20:60535642-60535664 ACACACTTCTAAATAACACATGG + Intergenic
1175690723 20:61064169-61064191 GCACACCAATATATACACCATGG - Intergenic
1175730714 20:61352018-61352040 GCACACTTAAAAATAACTAAAGG - Intronic
1176658375 21:9610200-9610222 GAGCACAAATAAACAACCCAAGG - Intergenic
1176878330 21:14158330-14158352 GCGTGCTTATAAATAACCCATGG + Intronic
1176896850 21:14389627-14389649 GCACACTTCTAAATAACCAATGG - Intergenic
1177383762 21:20381302-20381324 ACACACTACTAAATAACACATGG - Intergenic
1177390109 21:20457912-20457934 GCACACTTTTAAATAAAACAGGG - Intergenic
1178039568 21:28624741-28624763 GAACACTAATCAGGAACCCAAGG + Intergenic
1178380430 21:32103094-32103116 GCACCCTTCTAAATAATCCATGG - Intergenic
1178975146 21:37214835-37214857 GCATACTTTTAAATAACTCATGG - Intergenic
1179944534 21:44662847-44662869 ACACACTTCTAAATAACCCATGG + Intronic
1180031895 21:45216488-45216510 GCAGACTTCTAAATAACCCAAGG - Intronic
1180250559 21:46583973-46583995 GCACTCTACTAAATAACCAATGG + Intergenic
1181900268 22:26148330-26148352 GCAAACTTCTAAATAACCAATGG + Intergenic
1184121908 22:42456861-42456883 ACACACTTCTAAATAATCCACGG + Intergenic
1184308029 22:43621434-43621456 ACACACTTCTAAATAATCCATGG + Intronic
1184945388 22:47799166-47799188 ACACACTTGTAAATAACACATGG + Intergenic
949138768 3:605310-605332 ACACACTATTAAAGAACACATGG - Intergenic
949298085 3:2550048-2550070 GCACAATAAAAAATGACCAAGGG - Intronic
949487688 3:4555519-4555541 GCAAAATAATAAATAAACCATGG + Intronic
951455083 3:22882757-22882779 ACACACTTCTAAATAACCCATGG + Intergenic
951685345 3:25337723-25337745 GCACACAAAAAAATAAAGCAGGG - Intronic
951930487 3:27961279-27961301 GCACTCTAATAAAGACCACAGGG + Intergenic
951956476 3:28260847-28260869 ACGCACTTTTAAATAACCCATGG - Intronic
952360103 3:32622140-32622162 GTACACTCATAAATAACTAAAGG + Intergenic
952653126 3:35750324-35750346 ACACACCACTAAATAATCCACGG - Intronic
953224640 3:41006876-41006898 GTACACTTTTAAATAACCAATGG - Intergenic
953252060 3:41254374-41254396 GCACACTCCTAAATAATCCAAGG + Intronic
953429481 3:42826975-42826997 ACACACTCCTAAATAACCAATGG - Intronic
955297967 3:57750606-57750628 GAAAACTAATAAATATCTCAGGG - Intergenic
955555618 3:60133958-60133980 GCACAGTAATAAATAAACCTAGG - Intronic
956524766 3:70145582-70145604 ACACACTTCTAAATAATCCATGG + Intergenic
956898801 3:73692210-73692232 ACACACTTCTAAATAACACATGG - Intergenic
956975950 3:74579647-74579669 ACATACTTCTAAATAACCCAAGG + Intergenic
957672101 3:83318597-83318619 CCATACTTATAAATATCCCATGG - Intergenic
958135982 3:89492062-89492084 ACACACTTTTAAATAATCCATGG - Intergenic
958453940 3:94306888-94306910 GAACACCAAGAAATAACCAAAGG - Intergenic
958740947 3:98070829-98070851 ACACACTTCTAAATAACCCATGG + Intergenic
960495369 3:118367394-118367416 GCATACTACTAAATAACCAGTGG - Intergenic
961236020 3:125368635-125368657 GCACACTTTTAAATAATACATGG - Intronic
961350989 3:126302134-126302156 GCACACTTTTAAATAACCCATGG - Intergenic
961630226 3:128293036-128293058 GAACACTTATAAATAACCCATGG - Intronic
962000789 3:131294321-131294343 ACACACTTCTAAATAACACATGG - Intronic
962359975 3:134731492-134731514 ACACACTTCTAAATAACTCATGG + Intronic
962959790 3:140300167-140300189 GCAGTTTAATAAATAACTCAAGG + Intronic
963014854 3:140812695-140812717 ACACACTTCTAAATAACACATGG + Intergenic
963033052 3:140998245-140998267 GCATACTTCTAAATAATCCATGG + Intergenic
963165372 3:142196574-142196596 ACACACTTAAAAATAACCAAAGG - Intronic
965415744 3:168389939-168389961 ACACACTTCTAAATAACCCATGG + Intergenic
966168011 3:177043062-177043084 CCACACTTCTAAATAACTCATGG - Intronic
966535252 3:181025555-181025577 ACACACTTCTAAATAACCCATGG - Intergenic
967216464 3:187214871-187214893 GGACACTAATACAGAACCTAAGG - Intergenic
967444707 3:189553275-189553297 ACACACTTCTAAATAACCCATGG + Intergenic
967548058 3:190755729-190755751 GCACAATTTTAAATAACACATGG - Intergenic
967698241 3:192560115-192560137 GCACATTTGTAAATCACCCAAGG + Intronic
967960636 3:194920277-194920299 GTACACTTCTAAATAACACATGG - Intergenic
968190256 3:196662041-196662063 GGACACTACAAAATAATCCAAGG - Intronic
970229548 4:13894725-13894747 GCAAATGAATAAATAAACCATGG - Intergenic
970433153 4:16007579-16007601 GCACAAAATTAAATAAGCCATGG + Intronic
971422449 4:26486186-26486208 GCTCATTAATTAATAACCAAGGG + Intronic
971433016 4:26588669-26588691 ACACATTTATAAATAACCCATGG - Intronic
972352598 4:38250662-38250684 ACACACTTATAAATAACTCATGG - Intergenic
973273720 4:48287085-48287107 ACACACTTGTAAATAATCCATGG + Intergenic
973548715 4:52009130-52009152 ACGCACTTCTAAATAACCCATGG + Intronic
974677998 4:65121040-65121062 GCACACTTTTAAACAACCAATGG + Intergenic
975927817 4:79479912-79479934 GCACACTCCTAAACAACCAATGG - Intergenic
976627430 4:87201758-87201780 GCACACATCTAAATAATCCATGG + Intronic
977812237 4:101370291-101370313 ACACACTTCTAAATAACACATGG + Intergenic
979420241 4:120495195-120495217 TCATACTTCTAAATAACCCATGG - Intergenic
979563685 4:122129802-122129824 ACACACTTCTAAATAACACATGG - Intergenic
980285462 4:130773285-130773307 GCACAGTATTAAATATTCCATGG - Intergenic
980376232 4:131952330-131952352 GTACAATGATAAATAACACATGG + Intergenic
980879869 4:138698837-138698859 GCACAGCAAAAAATACCCCATGG - Intergenic
980923293 4:139109415-139109437 GCACAGTCATAAATAGCCAAGGG - Intronic
982392480 4:154880469-154880491 GCACTCTAATAAATATTCAAAGG + Intergenic
982806790 4:159775806-159775828 GCACAATAATTAATAAGGCAAGG + Intergenic
983354166 4:166633910-166633932 GCACACTTCTAAATAACACACGG - Intergenic
983599853 4:169515085-169515107 ACACACTTTTAAATAAACCATGG - Intronic
983835971 4:172385044-172385066 ACACACTTCTAAATAACCAATGG - Intronic
984264157 4:177476446-177476468 GTAAACTAATAAAAAACCCCAGG + Intergenic
984405009 4:179317640-179317662 ACACACTAATAAAAAACACATGG - Intergenic
984718725 4:182950752-182950774 ACACACTTTTAAATAACACATGG + Intergenic
984753955 4:183307217-183307239 GCACACTTCTAAATAACAGATGG + Intronic
984940265 4:184925220-184925242 ACTCACTCCTAAATAACCCAAGG - Intergenic
985016895 4:185645630-185645652 TCACACTCATATATAATCCAAGG - Intronic
985417038 4:189745876-189745898 GAGCACAAATAAACAACCCAAGG + Intergenic
988322747 5:29720938-29720960 ACACATTATTAAATAACCAATGG - Intergenic
990421829 5:55643289-55643311 GCATACTCTTAAATAACCAATGG - Intronic
991007939 5:61849137-61849159 GCACACTTCTAAGTAACACATGG + Intergenic
992033221 5:72745130-72745152 ACACACTTTTAAATGACCCATGG + Intergenic
993655125 5:90568371-90568393 GCACACTCCTAAATGACCAAAGG - Intronic
995726279 5:115184025-115184047 ACACATTTGTAAATAACCCATGG - Intergenic
996603390 5:125292779-125292801 ACACACTTGCAAATAACCCAGGG + Intergenic
996748584 5:126867340-126867362 CCACACTAGGAAATGACCCATGG - Intergenic
997107355 5:131035460-131035482 ATACACTAATAAATAACACATGG + Intergenic
997769174 5:136537934-136537956 ACACACTCCTAAATAACCAATGG + Intergenic
998732236 5:145092603-145092625 ACACACTACTAAATAACCAGAGG + Intergenic
999550449 5:152680672-152680694 GCACACTAATATATAGACAATGG + Intergenic
999556611 5:152750013-152750035 GCACACTACTGAATAACCAGTGG + Intergenic
999778765 5:154832094-154832116 GCACACTAATATATAAACAGTGG + Intronic
1000273832 5:159714257-159714279 ACACATTTCTAAATAACCCATGG + Intergenic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1002555497 5:180035283-180035305 GCACACATCTAAATAACACACGG - Intronic
1002564955 5:180106525-180106547 ACACACTTGTAAATAATCCATGG - Intronic
1002793810 6:454582-454604 ACACACTTCTAAATATCCCATGG - Intergenic
1002874040 6:1195229-1195251 ACATACTTTTAAATAACCCATGG + Intergenic
1002970785 6:2016800-2016822 GCATATTTCTAAATAACCCATGG + Intronic
1003215875 6:4110971-4110993 ACACACTTTTAAATAACCAATGG - Intronic
1003250335 6:4423521-4423543 ACACACTTATAAATAATGCATGG + Intergenic
1003282699 6:4707918-4707940 GCACACTATTAAATAACATTTGG - Intronic
1003576719 6:7303396-7303418 ACACAATAAAAAATAAACCAAGG - Intronic
1003763154 6:9204939-9204961 ACACACTTCTAAATAACCCATGG + Intergenic
1003944569 6:11062407-11062429 ACACACTTCTAAATAACACATGG - Intergenic
1004878850 6:19985291-19985313 GGACAGTAATGAATGACCCAAGG - Intergenic
1005210913 6:23461297-23461319 GCACACTTCTAAATAACCCGTGG + Intergenic
1005222590 6:23604481-23604503 ACACTCTCATAAATAACACATGG + Intergenic
1007885123 6:45218991-45219013 GCACACTTCTAAATAATCCATGG + Intronic
1009624330 6:66119209-66119231 ACACACTTACAAATAACACATGG + Intergenic
1009897236 6:69767452-69767474 ACATACTTCTAAATAACCCATGG - Intronic
1009993682 6:70876007-70876029 GCCCACTAAAAAATAATTCATGG - Intronic
1011095003 6:83651501-83651523 ACACACTTCTAAATAACACATGG - Intronic
1011236758 6:85227140-85227162 GCACACTACTAAAAAACTAATGG + Intergenic
1011913776 6:92475796-92475818 ACACACTTCTAAATAACACATGG + Intergenic
1012391384 6:98744639-98744661 GAACACTAATAGACAACCTAAGG - Intergenic
1013441187 6:110171316-110171338 TCACACTTCTAAATAACACATGG + Intronic
1013675049 6:112449751-112449773 GCACATTTATAAATAACCCAAGG - Intergenic
1013952494 6:115801047-115801069 ACACACTTTCAAATAACCCAAGG + Intergenic
1014062380 6:117086795-117086817 ACACACTTCTAAATAATCCATGG + Intergenic
1015597226 6:134877367-134877389 GCACACTAGTACATGACCCAAGG - Intergenic
1016365342 6:143310377-143310399 GCACACTAATAAATAACCCATGG + Intronic
1016417517 6:143848595-143848617 GCACAGAGATAAATAACACATGG + Intronic
1016430419 6:143978589-143978611 TCACACTTCCAAATAACCCAGGG - Intronic
1016727248 6:147387196-147387218 CTACAGTAATAACTAACCCAGGG + Intergenic
1017817028 6:158023281-158023303 GCAAACAAACAAAAAACCCATGG + Intronic
1017914970 6:158824654-158824676 GCAAATTATTAAATAAGCCAAGG - Intergenic
1018693990 6:166375656-166375678 GCACACTTCTAAATAACTCTGGG - Intronic
1018780604 6:167060783-167060805 ACACACTCCTAAATAACCAATGG + Intergenic
1018939909 6:168302150-168302172 GCTGGCTAATCAATAACCCAAGG - Intronic
1019884966 7:3895839-3895861 ACACACTTATAAATAATCCATGG - Intronic
1020469132 7:8515872-8515894 GCAGAGTAATGAGTAACCCATGG - Intronic
1020848158 7:13314005-13314027 ACACACTACTAAATAACCCATGG - Intergenic
1021790293 7:24197806-24197828 GGAAAATAATAAATTACCCATGG + Intergenic
1023229190 7:38007558-38007580 TCACAGTGATAAAGAACCCACGG + Intronic
1023264139 7:38388570-38388592 ATACACTTCTAAATAACCCATGG - Intronic
1024124594 7:46279787-46279809 GTACACTGCTAAATAATCCATGG - Intergenic
1024166369 7:46735838-46735860 GCACAGTTCTAAATAACCCATGG + Intronic
1024205768 7:47159508-47159530 GCATACTTTTAAATAACACAAGG + Intergenic
1024227896 7:47341968-47341990 GCACACTTATAAATAATCTATGG - Intronic
1026682863 7:72481712-72481734 ACACACTTTTAAAAAACCCACGG - Intergenic
1027919082 7:84368113-84368135 GCTCACTTATAGATAACCCATGG + Intronic
1028727914 7:94110231-94110253 GCACAATAACAAATAACACTAGG - Intergenic
1029051924 7:97699148-97699170 GCACACTCTTAAACAATCCATGG + Intergenic
1029233967 7:99097013-99097035 TCACACTTCTAAATAATCCATGG + Intronic
1031287741 7:119892611-119892633 GCAAACTTCTAAATAACCCATGG + Intergenic
1031543134 7:123019942-123019964 GCACACTATTAAATAGCAAAGGG - Intergenic
1031879742 7:127183428-127183450 ACACACTTCTAAATAACACATGG + Intronic
1032058436 7:128703403-128703425 ACACACTTCTACATAACCCATGG + Intergenic
1033279914 7:139998775-139998797 GCACACAAACACACAACCCACGG - Intronic
1033575387 7:142677758-142677780 TCACACTCCTAAATAACTCATGG - Intergenic
1033985267 7:147218392-147218414 ACACACTTCTAAATAACACATGG - Intronic
1034583655 7:152069191-152069213 ACACATTTCTAAATAACCCATGG - Intronic
1035985162 8:4421569-4421591 ACACACTTCTAAATAATCCAGGG + Intronic
1037087951 8:14876237-14876259 ACACATTTCTAAATAACCCATGG + Intronic
1037371657 8:18185904-18185926 GGACACTTATAACTAAGCCAAGG - Intronic
1037955736 8:23056761-23056783 ACACACTTATAAATAATCCATGG - Intronic
1038140100 8:24835371-24835393 GAACAAAAATAAATAACCCTGGG + Intergenic
1039428199 8:37504376-37504398 ACACACTCAGAAATAAACCATGG + Intergenic
1039487326 8:37920837-37920859 GCATACTCCTAAATAACCAATGG - Intergenic
1040756770 8:50784937-50784959 GCAAATTACTAAATAACCAATGG + Intronic
1040853976 8:51930003-51930025 GCACACTAAACAAAATCCCAGGG - Intergenic
1041174730 8:55183492-55183514 GTATACTTGTAAATAACCCATGG - Intronic
1041185231 8:55292891-55292913 ACACACTGCTAAGTAACCCATGG - Intronic
1041289130 8:56291987-56292009 TCACACTTCAAAATAACCCATGG - Intergenic
1041561280 8:59222106-59222128 GCACATTTCTAAATGACCCATGG + Intergenic
1041768549 8:61446850-61446872 ACACAGTTCTAAATAACCCATGG - Intronic
1042304360 8:67315713-67315735 ACACACTTCTAAATAATCCATGG + Intronic
1042360101 8:67872525-67872547 TCACAGTCATAAATAACACATGG + Intergenic
1042576941 8:70231463-70231485 GGCCACTAATCAATCACCCAAGG + Intronic
1043649414 8:82571168-82571190 GCACACATCTAAATAACTCATGG + Intergenic
1044213324 8:89577320-89577342 GTACACTTCTAAATAATCCATGG - Intergenic
1046016490 8:108611478-108611500 GAAAACTAAAAAATACCCCAAGG - Intronic
1046222754 8:111236838-111236860 ACTGACTAATAAATAGCCCATGG + Intergenic
1046502070 8:115091190-115091212 GCACACTTCTAAATAATACAGGG - Intergenic
1046608586 8:116398338-116398360 ACACACTTCTAAATAATCCATGG + Intergenic
1046993225 8:120485326-120485348 ACACACCAACAAATAACCAATGG - Intronic
1047235643 8:123039884-123039906 GCAGACTAATAAATACCAAAGGG + Intronic
1047326695 8:123845575-123845597 ACACACTTCTAAATAACCCATGG - Intergenic
1047564513 8:126027611-126027633 ACACACTACTAAATAAGCAATGG + Intergenic
1047890802 8:129306615-129306637 GTACAGTAATAAATAATACAAGG - Intergenic
1048292036 8:133188538-133188560 TGTCATTAATAAATAACCCAAGG - Intergenic
1048790156 8:138094372-138094394 ACACACTTATAAATAATTCAGGG + Intergenic
1049077887 8:140414685-140414707 GCACACAGCTAAATAACCAATGG + Intronic
1050316906 9:4411721-4411743 GCTCCCAAAGAAATAACCCATGG + Intergenic
1050428844 9:5540874-5540896 GCACCCTAATACAAAAACCAGGG + Intronic
1050748591 9:8908476-8908498 GCACATTTTTAAATAACCCATGG + Intronic
1050900694 9:10944974-10944996 ACACATTTATAAATAATCCATGG + Intergenic
1051312827 9:15794757-15794779 GAATACTAAAACATAACCCAAGG - Intronic
1051324837 9:15954433-15954455 ACACACTCTTAAATAACCAATGG - Intronic
1052199591 9:25762085-25762107 GAACACTAATAAACAACTCAAGG + Intergenic
1052393570 9:27910116-27910138 TCACACTAATAAATGAACCTTGG + Intergenic
1052555343 9:30007115-30007137 GCACAATAATCAATATGCCAAGG + Intergenic
1053327359 9:37166802-37166824 ACACACTTCTAAATAACCCCTGG - Intronic
1053491750 9:38511459-38511481 ACACACTTCTAAATAATCCATGG + Intergenic
1054838245 9:69703594-69703616 ACACACTCATAAATAACCAATGG - Intergenic
1055900728 9:81232541-81232563 AAACACTTCTAAATAACCCATGG - Intergenic
1056207052 9:84329563-84329585 GCACACTCCTAAATAACCAATGG + Intronic
1057672047 9:97100658-97100680 ACACACTTCTAAATAATCCATGG + Intergenic
1057715250 9:97488908-97488930 GCACAGTTCTAAATAACACATGG - Intronic
1058791925 9:108456133-108456155 GCTCATTAATAAATTAGCCATGG + Intergenic
1058879752 9:109276197-109276219 ACACACAAATAACAAACCCAAGG + Intronic
1059045902 9:110866295-110866317 ACACACTTCTAAATAACACATGG - Intergenic
1059582719 9:115568616-115568638 ACAGACTAATAAACTACCCAAGG + Intergenic
1061744844 9:132732038-132732060 GTACACTAATAACTATCACACGG - Intronic
1062648373 9:137562440-137562462 ACACACTCATAAATAACCAATGG + Intronic
1203636106 Un_KI270750v1:113775-113797 GAGCACAAATAAACAACCCAAGG - Intergenic
1185970994 X:4663477-4663499 GCACACTCATAAATAACCAATGG + Intergenic
1186132648 X:6484951-6484973 ACACACTTATAAAGAACCTAGGG - Intergenic
1186291160 X:8100725-8100747 CCACACTGGTAAATAACACATGG + Intergenic
1186684374 X:11909787-11909809 GCACAATGCTAAATAACTCATGG - Intergenic
1188039230 X:25352553-25352575 GCACAGTGATAAATAAGGCAGGG + Intergenic
1188257966 X:27985667-27985689 ACAAACTAATAAATAAGACATGG + Intergenic
1189610696 X:42731007-42731029 ACACACTCCTAAATAACACATGG + Intergenic
1189823714 X:44895739-44895761 ACACACTACTAAATACTCCATGG - Intronic
1189934110 X:46047879-46047901 ACACACTTCTAAATAACACATGG + Intergenic
1190043808 X:47095914-47095936 ACACACTTCTAAATAATCCATGG - Intergenic
1192063421 X:67855128-67855150 GCACACTTTTAAATAATGCATGG - Intergenic
1192354928 X:70393189-70393211 TAACACTTCTAAATAACCCATGG - Intronic
1192545967 X:72014551-72014573 ACACACTTTAAAATAACCCATGG - Intergenic
1192990671 X:76452989-76453011 GCACGCTACCAAACAACCCATGG - Intergenic
1193400391 X:81035949-81035971 GCACAATAAAAAATAACAGAGGG + Intergenic
1193429350 X:81381978-81382000 GCACACTCCTAAATAGCCAATGG - Intergenic
1193623134 X:83782064-83782086 ACACACTTCTAAATAACACATGG + Intergenic
1193843561 X:86439878-86439900 ACACACTTCTAAATAACACAAGG - Intronic
1193855525 X:86597426-86597448 ACACACTTCTAAATAACCAAAGG - Intronic
1193856068 X:86603899-86603921 CCACACTTCTAAATAACCCATGG - Intronic
1194376491 X:93140061-93140083 ACACACTACTAAATAACCAATGG - Intergenic
1194484364 X:94469894-94469916 TGACACTTCTAAATAACCCATGG + Intergenic
1195206871 X:102610030-102610052 ACACACTCTTAAATAACCAATGG - Intergenic
1195634095 X:107093472-107093494 ACAAACTTCTAAATAACCCATGG + Intronic
1195819459 X:108928677-108928699 ACACACTTTTAAATAACCCATGG - Intergenic
1195897858 X:109766357-109766379 ACACACTTCTAAATAACACATGG + Intergenic
1196293407 X:113970628-113970650 ACACACTCCTAAATAACCAACGG - Intergenic
1197090948 X:122536627-122536649 GCACACTTCTAAATAACCCATGG + Intergenic
1197450641 X:126611056-126611078 ACACACTTCTAAATAACCCACGG - Intergenic
1197952995 X:131918044-131918066 GCACACTACTAAACAACCAATGG + Intergenic
1198319138 X:135501843-135501865 GCACATTTCTAAATAATCCATGG - Intergenic
1199658915 X:150026994-150027016 GCACACTTCTCAATAATCCATGG + Intergenic
1199739627 X:150722002-150722024 ACACACTCCTAAATAACTCAAGG - Intronic
1199779088 X:151041720-151041742 ACATACTTATAAATAACACATGG - Intergenic
1199919171 X:152379344-152379366 ACACACTTCTAAATAACTCATGG + Intronic
1199934313 X:152556442-152556464 ACACACTTAAAAATAACCAATGG - Intergenic
1200078258 X:153562566-153562588 GCACCCTGATCAATAATCCATGG + Intronic
1201337590 Y:12897069-12897091 TCACAATAATAAATAACACATGG + Intergenic
1201615538 Y:15893611-15893633 ACACACTTATAAAGAACCTAGGG - Intergenic