ID: 1016369956

View in Genome Browser
Species Human (GRCh38)
Location 6:143363174-143363196
Sequence GCTGTTATTACTCACAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016369956_1016369958 1 Left 1016369956 6:143363174-143363196 CCAGCATTGTGAGTAATAACAGC No data
Right 1016369958 6:143363198-143363220 TTGCTACATTTTCTCAAAATGGG No data
1016369956_1016369957 0 Left 1016369956 6:143363174-143363196 CCAGCATTGTGAGTAATAACAGC No data
Right 1016369957 6:143363197-143363219 ATTGCTACATTTTCTCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016369956 Original CRISPR GCTGTTATTACTCACAATGC TGG (reversed) Intergenic
No off target data available for this crispr