ID: 1016371027

View in Genome Browser
Species Human (GRCh38)
Location 6:143374269-143374291
Sequence GACTCAAAGGGGGTCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016371017_1016371027 22 Left 1016371017 6:143374224-143374246 CCTTCTGGTGGCCTGCAGGACAG No data
Right 1016371027 6:143374269-143374291 GACTCAAAGGGGGTCTTGAGAGG No data
1016371020_1016371027 11 Left 1016371020 6:143374235-143374257 CCTGCAGGACAGGTGGCAAACTC No data
Right 1016371027 6:143374269-143374291 GACTCAAAGGGGGTCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016371027 Original CRISPR GACTCAAAGGGGGTCTTGAG AGG Intergenic
No off target data available for this crispr