ID: 1016372207

View in Genome Browser
Species Human (GRCh38)
Location 6:143386811-143386833
Sequence GGTTCAAGGGGTCCATGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016372201_1016372207 8 Left 1016372201 6:143386780-143386802 CCACACTTTTTTGTTTTCAACTT No data
Right 1016372207 6:143386811-143386833 GGTTCAAGGGGTCCATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016372207 Original CRISPR GGTTCAAGGGGTCCATGTTC AGG Intergenic
No off target data available for this crispr